1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bonufazy [111]
3 years ago
15

What process powers the movement of tectonic plates? Describe how this process works.

Biology
1 answer:
castortr0y [4]3 years ago
6 0

The tectonic plates move and shift due to Mantle convection

Mantle convection is caused by the magma in the mantle of the earth constantly being cooled near the crust and heated the closer it gets to the core and like normal convection the cool magma sinks towards the crust and the hot magma rises to the crust. this happens in a circular motion causing the crust to shift with the magma 

You might be interested in
All
egoroff_w [7]
Hey don’t listen to the files ok? I’m pretty sure they have viruses on them
8 0
3 years ago
We consume significant amounts of what vitamin in an inactive form?
Art [367]
Vitamin A; it is a soluble vitamin in fatty bodies, which can not be released in the urine as other vitamins normally do, it is said that we consume large quantities in an inactive form since this is necessary for many human body processes such as vision, formation and maintenance of skin cells, the immune system, growth and even lactation and embryonic development, therefore it is not necessary to be active to consume large amounts of this vitamin.
6 0
3 years ago
A client has been diagnosed with aplastic anemia. the nurse is aware that the client’s lab results will identify:
shutvik [7]
In aplastic anemia, then lab result will be decreased in all blood component( white blood cells, red blood cells, and thrombocyte). 
Aplastic anemia is caused by the bone marrow failure. Bone marrow is the place that produces blood cells, so the decrease wouldn't be in the red blood cell only, but in other blood cells too. There shouldn't be any iron deficiency or decreases in the mean corpuscular volume
5 0
3 years ago
Explain why flowers are important to a plant ?
julsineya [31]

Because they are reproductive organs of a plant

5 0
3 years ago
Which structure of the cell contains the cell's genetic information?
MAVERICK [17]
<span>The cell nucleus contains the majority of the cell's genetic material in the form of multiple linear DNA molecules organized into structures called chromosomes.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Explain your results in terms of the endocrine system. indicate how the endocrine system is involved in the physiological respon
    5·1 answer
  • Which component of acid rain kills plants and harms soil? 6.2?
    5·1 answer
  • Which scenario is an example of a negative feedback loop?
    10·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What will most likely happen if the gene frequencies in a given population remain constant?
    14·1 answer
  • What primarily determines airway resistance in the respiratory passageways?
    8·1 answer
  • A scientist studies the DNA in corresponding genes of a platypus, a
    13·1 answer
  • Lysosomes are organelles that contain enzymes. Which of the following is a function of lysosomes?
    9·2 answers
  • GCGAATTGC<br> Which of the following mRNA strands would be synthesized from the DNA strand above?
    14·2 answers
  • Which statement about an ecosystem is incorrect?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!