1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
12

Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in upperca

se, introns are in lowercase. The underlined AUG is the translation start codon. ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC After splicing, what will the sequence of the RNA be?
Biology
1 answer:
Hunter-Best [27]3 years ago
7 0

Answer:

ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

Explanation:

Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.

Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC  

After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

You might be interested in
What elements are find in a high proportion in earths crust
-Dominant- [34]
<span>The elements that are found in a high proportion in Earth's crust are oxygen, aluminium, iron, calcium, potassium, sodium, and magnesium. But for your Option, I think it is B) Oxygen and Silicon. This is because Oxygen makes 46.6% while Silicon makes 27.7% of the Earth crust.</span>
8 0
3 years ago
The part of the ear that vibrates first when sound waves enter the ear is the what
aivan3 [116]
Sound waves enter the outer ear and pass into the ear canal where the waves cause the eardrum to vibrate.
Hope this helps you.<3
4 0
4 years ago
Read 2 more answers
During which phase of mitosis does the nuclear envelope re-form?
LiRa [457]

Answer:

In which phase of mitosis do chromosomes align at the center and spindle fibers become visible? Explanation: Mitosis involves four distinct stages: prophase, metaphase, anaphase, and telophase. Prophase is the first step of mitosis, during which chromosomes condense and the nuclear envelope dissolves.

6 0
3 years ago
Earth Science <br><br> How much of the earth is water and how much of the earth is land?
Fantom [35]

Answer:

In simplest terms, water makes up about 71% of the Earth's surface, while the other 29% consists of continents and islands.

Explanation:

8 0
2 years ago
Read 2 more answers
Is DNA based on it organizing morphological traits
pogonyaev
I think ur face is a rat and gorilla I eat humans oh yeaa so don’t oh yeaaa
4 0
3 years ago
Other questions:
  • A polypeptide in a wild type microbe contains the sequence Leu-Pro-Tyr-Ser-Pro. A phenotypic variant of the species has the pept
    9·1 answer
  • Which elements are part of an area's topography? Check all that apply.
    10·1 answer
  • Which of these is a way to conserve freshwater
    11·2 answers
  • Place the steps involved in the process of bacterial transformation in the correct order.
    8·2 answers
  • Can someone help me please❤️
    10·2 answers
  • Some present-day bacteria use a system of anaerobic respiration characterized by an electron transport chain analogous to that f
    15·1 answer
  • Define synapsis. In what stage does it occur?
    10·1 answer
  • Describing Competition
    9·1 answer
  • Explain the function of enzymes and how enzymes<br> can be denatured.
    12·1 answer
  • LET'S CHECK
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!