1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
12

Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in upperca

se, introns are in lowercase. The underlined AUG is the translation start codon. ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC After splicing, what will the sequence of the RNA be?
Biology
1 answer:
Hunter-Best [27]3 years ago
7 0

Answer:

ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

Explanation:

Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.

Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC  

After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

You might be interested in
What impact does fast food have on adolescent obesity?
BartSMP [9]
Fast Food often contains more sodium, carbs and sugar counts than most home cooked or healthy meals. For kids whos parents are on a budget, fast food is the often option for meals, causing calorie counts to build up, eventually turning into stages of obesity. The average child calorie intake is between 1,600-2,500 per day. It is also recommended that children under age 18 should refrain from sodium counts higher than 2,200 per day. For one meal at McDonalds, to get a cheeseburger, fries and a coca-cola beverage, you are looking at around 1,100 calories and 1,200 mg of sodium. If the child eats this two times a day, the total calorie count would be above the national average, therefore causing the child to gain weight off the extra calories.
7 0
3 years ago
What is the term for when two different populations reproduce at different times? *?
ivanzaharov [21]
Offset sexual reproductions 

3 0
3 years ago
If a plant with purple petals (PP) is crossed with a plant with white petals (pp), what is the phenotype for the F1 generation?
Nonamiya [84]
The genotype for the F1 generation is PURPLE PETALS.
In cross breeding, the offspring of the original generation in a cross are called F1 generation. When two breeding of a particular living organisms are crossed, then the F1 generation will be all the same.<span />
8 0
3 years ago
Read 2 more answers
The risk index for a tsunami occurring in indonesia is 9.7 out of a maximum of 10 how could you prevent a tsunami from being a d
Reptile [31]

Answer: Protect yourself from the earthquake or volcanic eruption when it occurs because when this happens it is very likely that a tsunami will follow. Escape from the epicenter of the disaster, get as far away as possible from the water and get to a place as high as possible.

Explanation:

Indonesia is an archipelago of almost 20 thousand islands and it is located on the Pacific "Ring of Fire" which is a region where many volcanic eruptions and earthquakes occur independently of other events in other parts of the Ring. This means, <u>Indonesia is vulnerable to volcano eruptions and earthquakes that eventually will cause tsunamis.</u>

A tsunami is a complex event involving a group of waves in water of high energy and variable size that occurs when a large body of water is vertically displaced by some extraordinary phenomenon, for example, an earthquake, volcanic eruption, landslides, underwater detonations, meteorite impact, glacial ice slides, and others. So it is generated by the displacement of water.

The rist index for a tsunami to occur there is 9.7 of 10, this means that such an event is highly likely to occur. Since it is a natural phenomenon, there is no way to prevent it, however, there are several actions to take into account to avoid suffering major damage when this happens. <u>This basically consists of protecting yourself from the earthquake or volcanic eruption when it occurs because when this happens it is very likely that a tsunami will follow</u>. So you have to take it as a warning sign to flee in time. The most important thing is to escape from the epicenter of the disaster, logically get as far away as possible from the water and get to a place as high as possible, such as a mountain. It is necessary to be aware of the news and warnings to monitor the situation.

4 0
3 years ago
There is only one copy machine at your office. You have to make 1000 copies of an expense report. After you begin copying, two o
saveliy_v [14]

Answer:

So its kinda obvious that its C:Let both of your other co workers do their copies and then finish yours...

8 0
3 years ago
Read 2 more answers
Other questions:
  • The original source of all genetic variation is _____. the original source of all genetic variation is _____. natural selection
    6·1 answer
  • Rebecca tells tom that he is singing “off pitch.” rebecca is referring to which physical property of sound?
    15·1 answer
  • How long does impacted wisdom teeth removal take?
    14·1 answer
  • When you walk your dog, you are using energy from the sunlight to power this activity. Explain.
    15·1 answer
  • Why do leaves appear green in color?
    8·2 answers
  • The human stomach contains acids that aid in digestion. a stomach enzyme was placed in a solution that contained no acid. why di
    8·1 answer
  • In metaphase where do sister chromatids go?
    12·2 answers
  • Are physical characteristics of an organism not genetically passed down?
    12·1 answer
  • Atoms of which two elements have a combined total of 23 protons?
    15·1 answer
  • Help me will give brainiest <br> please and thank you
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!