1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
12

Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in upperca

se, introns are in lowercase. The underlined AUG is the translation start codon. ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC After splicing, what will the sequence of the RNA be?
Biology
1 answer:
Hunter-Best [27]3 years ago
7 0

Answer:

ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

Explanation:

Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.

Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC  

After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

You might be interested in
A student likes to attend football games, no matter how cold and snowy the weather becomes. She is going to a game on a very col
Rus_ich [418]

Answer:

hold on a few minutes I'm going to do my research and I will get right back to you with what I can find

3 0
3 years ago
Which best describes STRs?
tankabanditka [31]

Answer:

Option- B

  • <u>STRs( Short tandem repeat polymorphism)</u> is best described by a piece of coding DNA that consists of 9–80 repeating sequences of base pairs.

7 0
3 years ago
Read 2 more answers
ILL GIVE U BRAINLIEST!!!
kotegsom [21]
Fluffy
they do have a layered look
no they actually are very white
form 1-1.5 miles above earth
they can extend
8 0
4 years ago
Read 2 more answers
Which species interaction applies to bees that harvest nectar and pollen from flowers?
Elden [556K]
They are a very good example of mutualism in which each species benefits.  Please mark Brainliest!!!
4 0
3 years ago
The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the role
Viktor [21]

Answer:

A) Lipid synthesis : Smooth endoplasmic reticulum.

B) Calcium ion storage : Smooth endoplasmic reticulum.

C) Poison detoxification : Smooth endoplasmic reticulum.

D) Protien synthesis : Rough endoplasmic reticulum.

E) Protien modification and sorting : Golgi apparatus

F) Cisternal maturation : Golgi apparatus.

G) Macromolecule digestion : Lysosomes

H) Autophagy : Lysosome.

Explanation:

<u>Smooth endoplasmic reticulum</u> is involved in the synthesis and storage of lipids . It also stores the calcium ions and contain enzymes responsible for the detoxification of the poisonous substances like CCL4 and other agents. SO the answer of A , B  and C is Smooth endoplasmic reticulum.

<u>Rough endoplasmic reticulum</u> contains ribosomes which synthesize protiens thus answer of D is RER.

The <u>Golgi apparatus</u> functions as a factory in which the protiens recieved from the endoplasmic reticulum are modified and sorted and is also involved in cysternal maturation so answer of option E and F is Golgi apparatus.

<u>Lysosomes</u> are the part of endomembrane system involved in the digestion of the macromolecules and in the recycling of the worn-out organelles hence also involved in autophagy. Hence answers of G and H is lysosomes.

7 0
4 years ago
Other questions:
  • Explain how deforestation contributes to global warming.
    9·2 answers
  • What is the most likely result if the shape of the enzyme changes?​
    6·1 answer
  • Which is not a disease contracted through contaminated water?
    14·2 answers
  • The cell membrane is made up of _____. a double layer of cellulose a single layer of cellulose a double layer of protein a doubl
    5·1 answer
  • Has regulatory areas for thirst, hunger, body temperature, water balance, and blood pressure
    15·1 answer
  • Blood leaving the right ventricle will move through pulmonary arteries, then 1 point
    11·1 answer
  • Why does socialization have more to do with race than genetics?
    14·1 answer
  • What is each step in a food chain/food web called?
    6·1 answer
  • Will mark brainlist if the answer is correct
    5·1 answer
  • Which items are sources of soil pollution or soil pollutants?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!