1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novay_Z [31]
4 years ago
9

In a phase, how do physicist define energy

Biology
1 answer:
Virty [35]4 years ago
3 0
Energy doesn't mean it's necessarily available to do work. energy exists in several forms such as heat, kinetic or mechanical energy, light, potential energy, and electrical energy. (etc.)
You might be interested in
In order to dilute a solution, you need to
Vera_Pavlovna [14]
B: add more water Explanation: it makes sense
7 0
3 years ago
Transcription is the transfer of genetic instructions in DNA to tRNA.<br> True<br> False
Mila [183]
Totaly false false is the CORRECT answer!
6 0
3 years ago
TRUE/FALSEThe telephone book shows relationships and is, therefore, a good example of a natural system of classification.
rewona [7]
False
It just shows your address and phone number
4 0
3 years ago
Choose one of the 3 systems
Alex777 [14]

Answer:

<h3>for digestive system ( similarities)</h3>

Explanation:

1. All three digestive systems take up majority space inside their bodies

2. All three of the animals food prey begin through the mouth and end through the anus

3 0
3 years ago
Individuals who are considered fit, have:
Schach [20]

Answer:

c or d

Explanation:

it is most likely c because people who are fit have stronger/healthier genes that have less mutations.

8 0
3 years ago
Other questions:
  • What does the term natural selection mean
    11·2 answers
  • Which process mitosis or meiosis repairs skin following sunburn
    5·1 answer
  • Deformation pushes, pulls, or twists the rocks in Earth’s crust. Which type of deformation tends to shorten part of the crust?
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Where does the calvin cycle of photosynthesis take place?
    11·1 answer
  • Fill in the blanks please help thx.
    12·1 answer
  • WILL IVE BRAIN?? Why might humans not have widespread regeneration abilities?
    9·1 answer
  • Distinguish between plant and animal cell
    10·2 answers
  • Are my answers right?<br> i'll mark you as a brainliest
    14·1 answer
  • True or false: Theoretically, it is possible (but very difficult) for a population to not evolve for a while.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!