I should be asking you the same thing huh
5’ tacatgatcatttcacggaatttctagcatgta 3’
3’ atgtactagtaaagtgccttaaagatcgtacat 5’
Only one of the two DNA strands serve as a template for transcription. It is called the template strand or antisense strand of DNA and is read by RNA polymerase from the 3' end to the 5' end during transcription (3' → 5'). However, the complementary RNA is created in the opposite direction, in the 5' → 3' direction, matching the sequence of the sense strand.
Nucleus organelle is the .....
Clonal selection of lymphocytes leads to the development of Effector cells and Memory Cells.
The criterion for categorizing epithelia as simple, stratified, or pseudostratified is the Arrangement of cells
The name "pseudostratified" refers to the way this epithelium appears in the section, which gives the false impression (pseudo meaning almost or approaching) that there are more than one layer of cells present while, in fact, all of the cells are resting on the basement membrane.
The respiratory airways are where pseudostratified columnar epithelia are most frequently observed. Cilia are present on the apical surface of these cells. Cilia are fluid-moving cells that beat in unison to move fluid in a fixed direction. The so-called pseudostratified epithelium is a unique variety of single columnar epithelium. Its name was taken from the way it looked.
To learn more about pseudostratified please visit-
brainly.com/question/10098118
#SPJ4