1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anarel [89]
2 years ago
13

Which of the following statements best describes the major difference between anaphase of mitosis and anaphase I of meiosis? In

anaphase I, homologous pairs are separated but sister chromatids stay joined together. In anaphase, spindle fibers pull each set of sister chromatids to opposite ends of the cell. In anaphase I, sister chromatids are separated, forming a total of four haploid cells. In anaphase, tetrads of homologous pairs are separated to form four new nuclei
Biology
1 answer:
Furkat [3]2 years ago
6 0
 In anaphase I, homologouspairs are separated but sister chromatids stay joined together. <span>The "I" in anaphase I refers to the first round of cell division, which resembles ordinary mitosis. So in anaphase I, the homologous pairs separate but the sister chromatids stay together. Then the cell goes directly into a second round of cell division - in anaphase II, the sister chromatids are separated into four (now haploid) cells.</span>
You might be interested in
What happens during the second trimester
netineya [11]

The babys organs will start to develop, and the baby will be able to sleep and hear other people outside the womb, the bby starts to grow more essential things it will need to live outside of the mothers womb.


3 0
3 years ago
Read 2 more answers
Why is scientific knowledge more reliable than other types of knowledge?
RUDIKE [14]

Answer:

D. Because science only uses facts that are proven 100% true through the use of  variables.

Explanation:

All the knowledge we read is science books are not merely some observed facts but the result of a systematic scientific methodology through which facts are tested. Science only gives us that knowledge as facts which is  proven 100% true through the use of  variables.For example: if a scientist has studied the effect of salt stress on the growth of plants and he got the results in form of graphs which show that growth of salt treated plants in very less than normal plants. Then he needs to draw conclusion after consulting relevant previous experiments and say that salt stress hinders growth and why? with reasonable logic.

Variables are the things hat he changes like environmental conditions in previous example to see that in changed conditions plant is showing changed behavior. This way a scientist strengthens his results. Therefore, we can say that whatever knowledge we get through science is proven 100% true through the use of  variables.

Hope it helps!

8 0
3 years ago
What are some differences between the "Steady State" and "Big Bang" theories?
Alex17521 [72]

Answer:

The major difference between the Big Bang theory and the steady state model is that the the big bang theory comes with the belief and idea that all the matter were created as a result of one big bang explosive beginning.

The steady state model matter however talks about matter being created at a steady rate through a specified time. The model also talks about the process being continual and is still happening till today.

7 0
3 years ago
How to solve problems of Transportation by using science​
Anna007 [38]
The best way to solve a transportation problem, is to give the following information:

m= The number of sources.

n= The number of destinations.

The total quantity available at each source.

The total quantity required at each destination.

The cost of transportation of one unit of the commodity from each source to each destination.
8 0
2 years ago
How does the respiratory system maintain homeostasis?
kotykmax [81]
Homeostasis is maintained by the respiratory system in two ways: gas exchange and regulation of blood pH. Gas exchange is performed by the lungs by eliminating carbon dioxide, a waste product given off by cellular respiration.
3 0
3 years ago
Other questions:
  • Which is the best microscope to get a detailed view of the part inside of a persevered plant cell
    6·1 answer
  • Which of these choices is a risk of replacing a coal-burning power plant with
    7·1 answer
  • Sarah is documenting her sources. Which step of research process is she on? A. Step 5: Cite Your Sources B. Step 4: Organize You
    12·2 answers
  • The portion of the membrane system In eukaryotic cells that is responsible for making liquids and breaking substance is the
    7·1 answer
  • How do enhancers accelerate the transcription of a gene?
    5·1 answer
  • in this phylogenetic tree, which two organisms on the tree would be expected to share the most characteristics
    6·1 answer
  • When you breathe, the diaphragm pulls down the abdomen and allows the ___________ to fill with air
    11·2 answers
  • Breaking a phosphate bond in an ATP molecule releases
    13·1 answer
  • Es una característica sexual primaria.
    6·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!