1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
10

Why an observation cannot be an inference

Biology
1 answer:
Dahasolnce [82]3 years ago
4 0

Answer:

An observation cannot be an inference, because an observation takes place before an inference can be determined.

Explanation:

You might be interested in
One of the primary advantages of cell culture is the ability to isolate a single type of cell from a multicellular organism. How
weqwewe [10]

Answer:

Scientists know that any response during an experiment is associated only with that cell type.

Explanation:

A cell culture is a group of cells that develops from a single original cell. Biologists can use cell cultures to test cell responses under controlled environmental conditions in order to study interactions between cells, and different processes occurs in it. Cell culture is one of the major tools used in the study of physiology and effect of toxic substances on the cells.

5 0
3 years ago
Which of the following atoms is NOT involved in the formation of hydrogen bonding?
aniked [119]

Answer:

ll.  Chlorine

Explanation:

Inbiochemical systems are oxygen (3.44) and nitrogen (3.04) while carbon (2.55) and hydrogen (2.22)

6 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The bubbles used to measure the rate of photosynthesis in pondweed are full of which<br> gas?
RUDIKE [14]

Answer:

Oxygen

Explanation:

5 0
2 years ago
What is required for both the light dependent and light independent reactions to proceed
damaskus [11]

Answer:

for light dependent , chlorophyll The pigment, sunlight and water. while for light independent co2 , ribose sugar ATP, NADPH

3 0
3 years ago
Other questions:
  • Why are producers important to energy transfer within an ecosystem?
    13·1 answer
  • The image shows a bean-shaped bacterium with long tail-like projections streaming from it.
    8·2 answers
  • Oil spills often kill many plants and animals in the affected area. What is the consequence of these mass die offs?
    15·2 answers
  • What controls the mass of an atom
    14·1 answer
  • The birth control pill is a good precaution against syphilis. <br> a. True <br> b. False
    14·2 answers
  • According to the Focus on Neuroscience box on the adolescent brain, the amount of gray matter in the brain peaks at about age __
    12·1 answer
  • Long-distance runners often run 20 kilometers or more at a time. What body systems do you think would be most involved in the en
    13·1 answer
  • David comes into the emergency room late at night with a cut that will not stop bleeding. His mother, Rose, is worried that he h
    12·1 answer
  • Which is a correct statement about mutations?
    14·1 answer
  • 1. What is a density-dependent limiting factor?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!