What is the main function of cellulose in plants? Provide physical support Apex

1 answer:

5 0

Cellulose is found in the cell walls of plant cells. It is permable so any substance disolveabls in water can pass through so it dose not act as a barrier. It gives the cell its strength and support. As water moves in to the cell by osmosis it stops the cell from bursting.

You might be interested in

Explain how beaches are created.

nikitadnepr [17]

Answer:

The waves erode seashells and rocks on the shore into small granuels called sand.

Explanation:

7 0

2 years ago

A dog Gave birth to four puppies. the father has brown eyes, and the mother has grren eyes. Two puppies have brown eyes. one has

maxonik [38]

This means that the mothers green eyes are recessive alleles and the fathers brown eyes are dominant alleles. The blue eyed puppy is blue eyed because there must have been a gene in the mothers or fathers past generation.

6 0

3 years ago

Which winds are usually warmer and more humid?

ivolga24 [154]

Answer:

Winds blowing from the ocean

Explanation:

Winds blowing from the ocean contain water vapor making the air more humid, and they also contain the heat which the water contains due to water's properties of having a steady temperature and high specific heat capacity.

7 0

2 years ago

What is the worse color for photosynthesis?

marin [14]

hot pink......................................

7 0

3 years ago

Read 2 more answers

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago