1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luden [163]
3 years ago
8

The difference between the highest high tide and the lowest tide is called the

Biology
2 answers:
Drupady [299]3 years ago
6 0

I think the answer is most likely A

KATRIN_1 [288]3 years ago
5 0

its C. the tidal range

You might be interested in
The range of cattle egrets has expanded between 1937 and today. How would an ecologist likely explain the expansion of the cattl
Anit [1.1K]

A habitat left unoccupied by native herons and egrets met the biotic and abiotic requirements of the cattle egret transplants and their descendants  

Answer: Option B

<u>Explanation:</u>

The cattle egret was a species of Heron to be first seen in Greater Caribbean Basin. They acquired their name “Cattle egret” as they were found to be co-existing with the grazing cattle and feeding on the insects that come out during grazing and also feed on the ticks present on the cattle’s body.

The cattle egret within a span of few years showed a dramatic increase in its population. This was attributed by their high reproduction rate leading to their extensive population growth. They also do not have any predators devouring them. They also feed on anything and everything to survive be it insects, rodents or small reptiles. They were good flyers and they were also able to get accustomed to their surroundings and reproduce.

5 0
3 years ago
The process in which two organisms of different species provide health benetits to each other characterizes which of the followi
Serhud [2]

Answer:

Mutualism

Explanation:

It's a mutualistic symbiotic relationship! :)

8 0
3 years ago
What does acid have effect on an enzyme​
Vaselesa [24]

Answer and Explanation:

Most enzymes are proteins in nature hence they are sensitive to changes in the pH. Enzymes may be denatured by extreme levels of hydrogen ions. Any change in pH, even a small one, alters the degree of ionization of an enzyme’s acidic and basic side groups and the substrate components as well. Ionizable side groups located in the active site must have a certain charge for the enzyme to bind its substrate. Neutralization of even one of these charges alters an enzyme’s catalytic activity. Excessive acidity or alkalinity renders them inactive.

5 0
4 years ago
Which monomer serves as the building block of glycogen, a polymer made up of many glucose molecules?
fiasKO [112]

Answer:

Monosaccharide

Explanation:

6 0
3 years ago
Paramecium lab answer
Hoochie [10]

In this virtual lab, grow two species of paremecium in test tubes and record data on their population growth. Experiment shows that when grown together, one species will die, illustrating the competitive exclusion principle.

4 0
4 years ago
Other questions:
  • Which zone is inhabited by bottom feeding catfish crayfish aquatic worms clams and bacteria?
    15·1 answer
  • The actions of prostaglandins are typically localized near where they are produced. what type of communication is this?
    12·1 answer
  • What is a combination of a nuclear base and a sugar called?
    11·1 answer
  • What is the cause and effect of invasive species ?
    10·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Describe two different methods that can be used
    11·1 answer
  • Why we need proceduers and rules in classrooms?
    10·1 answer
  • how do you living and nonliving things interact with each other? how might the function of an ecosystem be affected if living an
    8·1 answer
  • Help please! Will give brainliest.
    13·2 answers
  • Eight bones make up the __________ , which encloses and protects the brain.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!