1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
4 years ago
6

Genetic engineering to create biomedical products that benefit society often involves of recombinant DNA technology. Recombinant

DNA is DNA that has ?
Biology
1 answer:
marusya05 [52]4 years ago
3 0
Im going with Genes inserted from other organisms. 
You might be interested in
How does Amyotrophic lateral sclerosis disrupt homeostasis in the body? I NEED HELP pls
antiseptic1488 [7]

Answer:

ALS causes the motor neurons to gradually deteriorate, and then die. Motor neurons extend from the brain to the spinal cord to muscles throughout the body.

7 0
3 years ago
Minerals have a crystal structure, yet, crystals are relatively rare. What are the reasons for this?
Licemer1 [7]

Answer:

What are relatively rare are crystals of a size visible to the naked eye, and also showing most of the faces that reveal the internal symmetry of their atomic pattern.

Explanation:

Being crystalline, i.e. having a regularly repeated three-dimensional atomic pattern, does not mean that a mineral necessarily formed under conditions where it could nucleate (i.e. assemble as the tiny cluster of atoms that is the “seed” of a single crystal) and keep growing large flat faces until a regular shape becomes visible to the observer.

To a crystallographer who can seek proof of internal atomic order by X-ray diffraction, the actual size of a solid made of highly ordered matter is irrelevant. Specific techniques (variants of X-ray diffraction methods, or polarizing microscopy) can reveal that a solid material is made of a single crystal (i.e. a uniform atomic pattern is repeated in the same orientation anywhere throughout the solid) or consists of many crystals (the same pattern occurs, but it is oriented differently in what are considered individual crystals regardless of their individual shape or size).

For precision, a crystallographer or a mineralogist will use terms such as “monocrystalline” (the atomic pattern has a single orientation throughout the entire specimen, regardless of shape and size) and “polycrystalline” (the specimen is an aggregate, or collection, of “domains” or “grains” in which the atomic pattern is in an orientation different from its neighbours).

A perfect single crystal of quartz, broken in several chunks, doesn’t lose its internal atomic pattern, only its external “habit” (the overall shape imparted by the flat faces that grew, layer by layer, along directions controlled by the rate of addition to the atomic pattern). Each individual broken chip of quartz is considered “monocrystalline” by the mineralogist, even if none ofo them is the whole original crystal.

Most igneous and metamorphic rocks are polycrystalline, i.e. entirely made of crystals, often tightly packed and interlocked. You may discern individual grains mostly when light reflects off surfaces exposed by breaking along preferred directions within some minerals, or because grains from different minerals contrast in colour or luster. Few of the grains will have a regular geometric shape, despite each one being a single crystal. In the case of an igneous rock, some of the well-formed crystal are typically minerals who grew early from the still-liquid magma. Most of the other minerals simply filled the remaining space. If an igneous magma was “gassy” or “watery”, those volatiles may have remained trapped in the last stages of crystallization and formed late pockets in which a few crystals of exceptional quality grew from the remaining dilute magma and had the space needed to fully develop perfect faces. In many rocks, it is later fractures that provided an “open space” in which crystals could grow larger and with well-developed faces from hydrothermal fluids (overheated ion-rich waters), for the future delight of collectors.

3 0
3 years ago
Most streams result from _____. <br> a. altitude <br> b. melted snow <br> c. oceans <br> d. rivers
tatiyna

Answer:

....b........ melted snow

4 0
3 years ago
Read 2 more answers
How do free-living flatworms, tapeworms, and flukes eat?​
Molodets [167]

Answer:

Free-living flatworms ingest food

Explanation:

5 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Other questions:
  • When a bird eats a mall insects it can be considered a secondary consumer but what is the bird considered as when it eats seeds
    13·2 answers
  • Goosebumps are an example of:
    9·2 answers
  • What structure holds chromatids together in double stranded chromosomes? What are they known as
    7·1 answer
  • What is the ultimate base level of a stream
    6·2 answers
  • In rats, gene B produces black coat color if the genotype is B-, but black pigment is not produced if the genotype is bb. At an
    13·1 answer
  • An acute infection causing fever and convulsions with tonic spasms of skeletal muscles is called:
    5·1 answer
  • What is the answer i can’t figure this one out?
    11·1 answer
  • Does necrotizing fasciitis have a flagella?
    12·2 answers
  • HELP THIS IS DUE IN 1 HOUR (No links or I'll Report)
    6·2 answers
  • Identify the examples of absolute words below (multiple answers may be chosen).
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!