1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
6

Indicate if the following statements about prokaryotes are true or false. A. They contain a plasma membrane B. They contain inte

rnal membrane-bound organelles C. They have a cell wall D. They have ribosomes
Biology
1 answer:
lara [203]3 years ago
6 0

Answer:

A, C, D are true, B is false

Explanation:

Prokaryotic cells are surrounded by a plasma membrane, but they have no internal membrane-bound organelles within their cytoplasm. They have a cell wall and cytoplasm containing ribosomes

You might be interested in
An older adult client presents with noted burning pain along the thoracic region with a tingling sensation and extreme sensitivi
Westkost [7]
The skin care will use the period prevent pain so the eggs don’t dye well the kids also the pain
5 0
3 years ago
Complex sugars are called _____. A) monosaccharides B) disaccharides C) polysaccharides
Brums [2.3K]
Complex sugars are called polysaccharides. The correct answer is C. The Latin prefix poly- means many, so the entire name of this saccharide means that there are many atoms of sugar in it, which makes it a complex sugar. Di- in disaccharide means 2, and mono- in monosaccharide means 1, neither of which is complex.
5 0
3 years ago
Read 2 more answers
PLS HELP ASAP!! PPLLLEEAAASSSEEE
Vitek1552 [10]
I think it's a metal spoon is a thermal conductor and conducts heats quickly
8 0
3 years ago
Read 2 more answers
How is tectonic plates contribute to coal distribution
scoray [572]

Answer:

Coal can be transported from mines and processing plants to consumers in several different ways: Conveyors, trams, and trucks move coal around mines, short distances from mines to consumers close to the mines, or to other modes of long-distance transportation

Explanation:

4 0
3 years ago
Earth scientists have concluded that the methods of harnessing energy that have been used over the past two centuries, such as t
Kamila [148]
The best answer to the question that is being given above would be letter A. The most complex level of organization hierarchy that climate change could potentially affect is Earth's Biosphere - which holds every living thing in the planet. This climate change will destroy it more destruction to Mother Nature occurs.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Does cytoplasm contain all organelles
    15·1 answer
  • If the DNA sequence TTCACG is transcribed to AAGGC, what type of mutation has occurred?
    8·1 answer
  • Which part of the diagram represents the nucleus?
    14·1 answer
  • Check all of the statements that are true about comets. *
    14·1 answer
  • 2Ba(OH)2<br><br> Ba = <br><br> O = <br><br> H =
    9·1 answer
  • Please answer fast I need them soon as possible.
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please help me to answer this questions. If you help me to answer it I will give you brainiest​
    6·2 answers
  • If a boy exhibits a sex-linked trait that is carried on the X chromosome, what must be true?
    14·2 answers
  • Whats the smallest bird in the world?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!