1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
3 years ago
13

In an eukaryotic cell, mitosis is followed by ?

Biology
1 answer:
attashe74 [19]3 years ago
5 0

After Mitosis the cell completes its division by splitting its cytopplasm and re-building the last line of its cell memebrane

You might be interested in
What would happen to the concentrations of ATP, NADPH and Sugars if PSII stopped working? Would it decrease, increase or stay th
astraxan [27]
ATP is the correct answer your welcome
7 0
3 years ago
Does a substance in a solid state of matter have a definite shape and a definite volume?
vova2212 [387]
They cannot move freely but they can vibrate
8 0
4 years ago
Read 2 more answers
When a volcano erupts, tiny particles from which of Earth’s spheres are released into the air?
d1i1m1o1n [39]

Answer: C. Geosphere

brainliest?

3 0
3 years ago
If an organism that is incubated on a kligler iron agar slant produces a red slant and yellow butt, this indicates that the orga
Harlamova29_29 [7]

Klinglers iron agar medium is used to find the enterobacteria which can ferment glucose , lactose and hydrogen Sulphide . They are H₂S producing bacteria .

This media have phenol red as an indicator. When the glucose is fermented to acid , the production of acid turn the indicator from red to yellow, but it is then reoxidised and turns red again . When lactose is fermented it produce large amount of acid , and turn indicator yellow . Hence the slant will become yellow.And combination of ferrous sulphate and sodium thiosulphate helps in detection of H₂S which produce black color at the butt .

Learn more about indicator at : brainly.com/question/20264817

#SPJ4

4 0
1 year ago
Along a front, which type of air is always forced upwards? A. cooler, denser air
Roman55 [17]
b) warmer, less dense air

Hope I helped! ( Smiles )
3 0
3 years ago
Read 2 more answers
Other questions:
  • The semicircular canals of the bony labyrinth are responsible for detecting which type of stimulus?
    12·1 answer
  • Which statement correctly distinguishes between all mechanical and all electromagnetic waves?
    9·2 answers
  • Which sequence shows a decreasing level of complexity?
    15·2 answers
  • What will most likely be the result if all of the mitochondria are removed from a plant cell? a it will be unable to carry out r
    7·1 answer
  • The four basic parts of a flower are? Select one
    6·1 answer
  • Which best describes the top and bottom images of muscle contraction?
    9·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • I eat insect and frog eats me how am I​
    9·1 answer
  • A way of describing a chemical change that indicates what substances were present before the change and what substances are pres
    8·1 answer
  • The carrying capacity is the maximum number of individual organisms that ____.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!