1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
2 years ago
7

in humans, having freckles is dominant over not having freckles. A heterozygous male with freckles has children with a female wh

o does not have freckles. What fraction/percent of the children will not have freckles?
Biology
1 answer:
Kruka [31]2 years ago
6 0

Answer:

50%

Explanation:

If you do out the punnet square Ffxff, the result will be 50% of offspring with heterozygous (dominant trait is shown) and 50% will be homozygous recessive

You might be interested in
What feature of cells is best demonstrated in the image? А. Cells are the basic units of structure and make up tissues. B. Cells
Leokris [45]

Answer:

Cells are the basic units of structure and make up tissues.

Hope it helps :)

6 0
2 years ago
What is the definition of Polar Molecule?
4vir4ik [10]
A polar molecule has a positive and negative end because of electronegativity.
5 0
3 years ago
Two types of cells division which occur in male-female reproduction are reduction division (meiosis) and
o-na [289]

There are two types of cell division: mitosis and meiosis. Most of the time when people refer to “cell division,” they mean mitosis, the process of making new body cells. Meiosis is the type of cell division that creates egg and sperm cells.

  • thus the answer is <u>mitosis</u>

5 0
1 year ago
What is the answer :((( ?
amid [387]

The temperature of the water after adding the chemical.

8 0
2 years ago
This type of map indicates features of the land like oceans, mountains, and forests by using different colors.
ICE Princess25 [194]

Answer:

the answer to this question is: Physical Map.

hope this helps!

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • Identify two or three additional nutrients that are found in foods that contain complex carbohydrates
    8·1 answer
  • How does interphase prepare cells for mitosis
    10·2 answers
  • Bees use nectar from the flowers of plants as food. As they collect nectar, dustlike pollen grains stick to their body. When the
    12·2 answers
  • A bird is observed to nest along the coastline. It then spends hours out in the open ocean feeding on fish. What is this behavio
    15·1 answer
  • El Niño events are characterized by warmer than normal ocean temperatures near the equator in the Pacific Ocean. Which weather e
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help!!!!!!!!!asap!!!!
    8·1 answer
  • What happens to macromolecules from food during digestion?
    9·1 answer
  • Nhận định nào sau đây, ĐÚNG với cách di chuyển của giun đất
    12·1 answer
  • What is the largest species of sea turtle in the world?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!