1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
8

1. Why is genetic diversity within a population important?

Biology
2 answers:
LenaWriter [7]2 years ago
4 0
The correct answer is B

Genetic diversity allows for the organisms to have different genes that may ultimately lead to the ability to not be able to get diseases that might kill some of the organisms who don't have the gene.
blsea [12.9K]2 years ago
3 0
I think its a , but double check because i dont want it to be wrong .
You might be interested in
PLEASE HELP IM GIVING 69 POINTS LAST QUESTION!!!!
sashaice [31]

Answer:

C. 100% of the offspring will be red-eyed and 100% of females will be carriers.

Explanation:

         XR        XR

Xr    XRXr   XRXr

Y     XRY    XRY

C) 100% of the offspring will be red-eyed, and 100% of the female offspring will be carriers.

3 0
3 years ago
Read 2 more answers
Which one of the following has a lot of urea
asambeis [7]

Answer:

hepatic portal vein

Explanation:

6 0
3 years ago
Which of the following statements correctly describes the genetic material inside a virus?
natta225 [31]
Has DNA or RNA, never both
7 0
2 years ago
When we consume more proteins and wheat, the ph of the urine becomes more?
LenaWriter [7]
Neutral?

is this question legit or is this website like a fun answering game?
4 0
3 years ago
Explain genetic drift
Tomtit [17]

Answer:

variation in the relative frequency of different genotypes in a small population, owing to the chance disappearance of particular genes as individuals die or do not reproduce.

Explanation:

8 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • One full cycle of meiosis produces
    12·1 answer
  • I need help with this please:
    14·1 answer
  • Is the atmosphere a open or closed system?
    15·1 answer
  • Comparative morphology _____. A) compares the embryo development of organisms of different species B) compares the anatomy of or
    7·2 answers
  • A stock transfer can involve movements:______ A. Between different plants within the same storage location. B. Between stroage l
    5·1 answer
  • In the water cycle shown below, which process is happening at step 3?
    12·2 answers
  • Select all that apply. Which of the following are current human uses for chordates? food research therapy entertainment affectio
    10·1 answer
  • What is the most interesting<br> Or surprising thing you learned about the universe and galaxies?
    9·1 answer
  • Name 2 reasons why bacteria are resistant to antibiotics?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!