1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
e-lub [12.9K]
3 years ago
9

One important difference between a myelinated and unmayelinated axon is

Biology
1 answer:
inessss [21]3 years ago
3 0
Myelinated axons are insulated by myelin, and are therefore more effective
You might be interested in
What series of strongly-muscled vessels link together the dorsal and ventral blood vessels in an earthworm
Serjik [45]

Answer:

aortic arches (earthworms)

Explanation:

Earthworms vessels link together

4 0
2 years ago
How would you describe symmetry in invertebrates?
vodomira [7]

Answer:

Invertebrates can have bilateral or radial symmetry, or they can be asymmetrical. Bilateral symmetry means that the animal is arranged in the same way on both sides. Radial symmetry means the body parts are arranged in a circle around a central point.

4 0
3 years ago
A chemical has been found to harm the same compound in both prokaryotic and eukaryotic cells. Which compounds are those?
Mashcka [7]
I would have to say A. ribosomes are known to break and release their digestive juices into the cell upon cell death. thus killing them
5 0
3 years ago
What statement best describes how tornadoes form?
Finger [1]

Answer:

b warm wet air rises and punches cold dry air down causing the air to spin

5 0
3 years ago
Read 2 more answers
5. The burning of fossil fuels has increased the carbon dioxide content of the
posledela

One of the possible effects of increased carbon dioxide concentration on our planet would be a warmer climate.

<h3>Greenhouse effect</h3>

Carbon dioxide is one of the numerous greenhouse gases that exist in nature. The gases are responsible for the warming of the planet.

Carbon dioxide and other greenhouse gases form a blanket layer in the atmosphere and trap some of the reflected solar radiations from the sun, preventing them from escaping back to space.

The more the concentration of greenhouse gases in the atmosphere, the more the solar radiation that is trapped and the warmer the earth gets.

More on greenhouse effects can be found here: brainly.com/question/13706708

#SPJ1  

8 0
2 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Along with sweating, which other responses by skin assists with thermoregulation?
    8·1 answer
  • What changes that food undergo during<br>digestive processes?​
    9·1 answer
  • Two competing hypotheses to account for the increase in the number of Hox genes from the last common ancestor of bilaterians to
    11·1 answer
  • What happens to metabolism if calorie intake remains below BMR for a significant period of time?
    11·1 answer
  • A muscle that assists the muscle that is primarily responsible for a given action is a(n):__________
    6·1 answer
  • True or false: Smooth endoplasmic reticulum is the site of protein synthesis and rough endoplasmic reticulum is the site of lipi
    9·2 answers
  • What are the 2 types of cells (not plant and animal)?
    14·2 answers
  • Question is in the picture!
    7·1 answer
  • I will give points to anyone who answers!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!