1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
4 years ago
15

What effects did the introduction of the nutria have on ecosystems throughout the U. S.?

Biology
1 answer:
Finger [1]4 years ago
6 0

Answer:

Nutria is consider as a giant rodent animal having buck-toothed and web-foot and can grow  larger than 20 pounds.

According to the U.S. in 19th century nutria was first introduced in U.S. for the fur industry. But then they started damaging environment. Several effects caused by the nutria in U.S. are as following:

  • Damages all the flora in ecosystem and consume the entire plant, including the roots and no chances of that flora to grow back.
  • Nutria damages agricultural production by burrowing and causes infrastructure damage.
  • Nutria heavily feed feed on  plant roots which changes soil structure and convert the wetlands into water habitat.
  • They also causes soil erosion and  instability of agricultural lands

You might be interested in
The first line of defense involves which structures?
Ne4ueva [31]

Answer:

The first line of defense involves skin.

3 0
3 years ago
Read 2 more answers
Atoms of which 3 elements could bond together to form an organic compound
tensa zangetsu [6.8K]
An organic compound<span> is any member of a large class of gaseous, liquid, or solid chemical </span>compounds<span> whose molecules contain carbon. From this, you could be able to find the answer.</span>
8 0
3 years ago
Read 2 more answers
The bone of the lateral leg is the:
Dmitry_Shevchenko [17]

The answer is fibula

8 0
3 years ago
How do transitional fossils help explain the evolutionary steps that took place to produce modem organisms?​
lesya [120]

Answer:

Transitional fossils show how a particular taxa accumulated adaptations to fit particular environment​s and/or ecological niches

Explanation:

Transitional fossils are fossilized remains of taxonomic groups/species that illustrate an evolutionary transition between a known version of a taxa/species and the current taxa/species. Transitional fossils are fundamental because they can be clearly differentiated from the ancestral group as well as of its derived descendant group. For example, there exist transitional fossils known as "mammal-like reptiles"(i.e., therapsids that gave rise to the true mammals), which are clearly different from current mammals.

4 0
3 years ago
How many laws in biology ?????????/
Komok [63]

Answer:

Three Laws of Biology. “Social rules can be broken, but the laws of nature can't.”

A biological rule or biological law is a generalized law, principle, or rule of thumb formulated to describe patterns observed in living organisms. Many of these regularities of ecology and biogeography are named after the biologists who first described them.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Identify the role of carbon dioxide in photosynthesis.
    12·1 answer
  • Which organisms are both secondary and tertiary consumers in this food web?
    8·1 answer
  • Oil and petroleum are natural resources that are nonrenewable True or false
    14·1 answer
  • What should you do when someone takes things and hoards them?
    13·1 answer
  • If the wild-type codon is ggu, how many single-base substitutions will result in an amino acid substitution? include any changes
    10·1 answer
  • 1. What is an autosomal chromosome (an autosome)?​
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is the importance of the sequence of nucleotides in genetic information?
    12·1 answer
  • Evolution is a long and arduous process that has created humans with many different traits. Can you think of some genetic mutati
    10·1 answer
  • Need some quick help with this:
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!