1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gennadij [26K]
3 years ago
12

If it's 0 degrees outside and it's suppost to be twice as cold tomorrow how cold would it be?​

Biology
1 answer:
abruzzese [7]3 years ago
4 0

Answer:

Wala ko kabalo unsay I tubag

You might be interested in
A process that increases genetic diversity during meiosis is called
Irina18 [472]

Answer:

crossing over

Explanation:

7 0
3 years ago
Purple flowers are dominant to white flowers. A heterozygous purple flower is crossed with a white flower. What are the probabil
Zanzabum

Answer:

50% probability of Pp (purple) or pp (white) genotype.

Explanation:

P = purple gene

p = white gene

Punnet squares show the possible genotypes and probabilities of each genotype in the offspring of a cross:

Purple flower genotype (heterozygous) = Pp

White flower genotype = pp

Punnet Square:

\left[\begin{array}{ccc}&P&p\\p&Pp&pp\\p&Pp&pp\end{array}\right]

Potential genotypes for offspring are Pp and pp;

According to the Punnett square, 2 of 4 offspring will have the Pp genotype and the other 2 will have pp genotypes;

This means 2 should be purple and 2 white;

Or, there is a 50% chance of having either genotype, of being purple or white.

8 0
3 years ago
Read 2 more answers
What are the main factors that<br> determine Earth's climate?
KengaRu [80]

Answer:

temperature and precipitation

6 0
3 years ago
Read 2 more answers
Which of the following is a characteristic of all arthropods?
sasho [114]
Arthropods are a group of organisms which possess an exoskeleton, <span>jointed appendages, and segmented bodies. This group mostly includes insects, arachnids, and crustaceans. Therefore, the answer to the question above would be option C: jointed appendages. Hope this helps.</span>
8 0
3 years ago
Read 2 more answers
.) According to the video, how do they define a fossil?
Anna11 [10]

Answer:

searching

Explanation:

is the best way to find and search for the fossil

7 0
3 years ago
Other questions:
  • Eukaryotic cells achieve compartmentalization through an extensive endomembrane system that weaves through the interior of the c
    6·1 answer
  • Which situations would involve classification? Check all that apply. performing an analysis of an individual’s blood identifying
    8·2 answers
  • A plant breeder wants to breed a flowering plant species to produce seeds that will give a 50:50 mixture of blue and yellow flow
    9·1 answer
  • There are six elements that make up 99.9% of the human body. which one is responsible for most of the material found in teeth?
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • When does DNA replication take place
    6·2 answers
  • What muscle forms the labia of the mouth and controls most lip movement
    9·1 answer
  • 5. The cells that function with the sieve tubes are the
    6·1 answer
  • Analyze the importance to mollusks of the following adaptations: the mantle, mucus, and the muscular foot.
    15·1 answer
  • How is density affected when the salinity increases?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!