1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
3 years ago
14

Why is it important that antibodies have a symmetrical quaternary structure? to enable binding to many different antigens to cre

ate a variable region to create two identical binding sites for antigens to ensure a stable structure?
Biology
1 answer:
Morgarella [4.7K]3 years ago
3 0

<span>It is important that antibodies have a symmetrical quaternary structure to create two identical binding sites for antigens. An antibody is a relatively large protein having a Y-shape. Plasma cells produce antibodies which are then used by the immune system to fight off pathogens (e.g. bacteria and virus). The antibody is able to recognize the antigen of the pathogen. It binds with it either to neutralize it directly or “tag” the microbe for future attack by other parts of the immune system. </span>

You might be interested in
Most body water comes from ______, whereas most body water is lost via ______.
FrozenT [24]
Precipitation( condensation), evaporation

please vote my answer brainliest. thanks!
4 0
3 years ago
The Monterey pine and the Bishop's pine inhabit some of the same areas of central California. The Monterey pine releases pollen
Naddik [55]

Answer:

The Monterey pine and the Bishop's pine inhabit some of the same areas of central California. The Monterey pine releases pollen in February, while the Bishop's pine does so in April. This is an example of <u>temporal</u> isolation.

Explanation:

Temporal isolation is a form of reproductive isolation in which two or more species reproduce at two separate times.

<u>For example:</u> Northern america leapord frog mates in April and North America Bullfrog mates in july.

As in the given scenario, reproductive isolation is occuring in which two species (Monterey pine and Bishop's pine) are reproducing (producing pollens) at two separate times(February and April). Hence it is an example of temporal isolation.

3 0
3 years ago
Which of the following polymers is found in cell membranes?
inysia [295]
Lipids are found in cell membranes in double layer which is called "Lipid-bilayer".

So, option A is your answer.

Hope this helps!
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Help- I need to write a response pls- I have like 5-6 mins
docker41 [41]

Answer:

hjuhkjj

Explanation:

5 0
3 years ago
Other questions:
  • Which pulse point had the strongest pulse? the weakest pulse? why do you think this happened?
    14·1 answer
  • Which type of growth occurs when population growth slows or stops after a period of exponential growth?
    8·2 answers
  • It is crucial to study ocean microbes because _______. a. they control the major biogeochemical cycles that keep Earth’s biosphe
    15·2 answers
  • Why hydra is aceolomate inspite of having body cavity?
    13·1 answer
  • Is green light most or least useful in photosynthesis? Why?
    10·2 answers
  • What is the result of the cellular division process of Mitosis?
    8·2 answers
  • How is acetylcholine removed from the postsynaptic membrane?​
    5·1 answer
  • Drag the tiles to the boxes to form correct pairs. Not all tiles will be used. Match each type of skeletal marking to its functi
    11·2 answers
  • ASAP
    11·1 answer
  • How would an increasing shark population most likely affect this ecosystem?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!