Neurons are the main cell of the nervous system which is responsible for communication of organs and control of many bodily functions. Neurons transmit electrochemical signals which are known as neurotransmitters and neuromodulators that act as messengers for sensory input and motor output.
Also, the nervous system is composed of two main branches which are the central nervous system and the peripheral nervous system. The central nervous system is composed of the brain and spinal cord whereas the peripheral nervous system is composed of the nerves around the body.
Explanation:
Starting off, the conditions required for a seed to germinate are:
- warm temperatures, so that enzymes can act efficiently.
- water, for chemical reactions to place.
- oxygen, for respiration.
<u>Observations</u>:
Dry cotton wool: Seeds placed here will not germinate. They will not show any changes since not all the the conditions are met. (There's no water)
Wet cotton wool: Seeds placed here will germinate since all the conditions required for germinations to take place are met.
Covered with water: The seeds will gradually start to expand. The oxygen which is dissolved in water does not enter the seed due to excess water thus preventing germination.
This weak section of blood vessel is called an ANEURYSM. Aneurysm is defined as an excessive localized enlargement of an artery which is caused by the weakness of the artery wall. This weakness allows the artery to increase in size abnormally.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Bacteria,fungi and protists are all heterotrophs, taking their food source from something else. Fungus can also be used as food or as a pest, poisoning and killing plants in your yard (watermole- Potatoe famine). Protists: Protists have eukaryotic cells,and can be heterotropic but can be autotropic.
