1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
puteri [66]
3 years ago
7

In 3–5 sentences, explain how the shape of planetary orbits affects their orbital velocity. Include the proper law of planetary

motion as part of your answer.
Biology
1 answer:
skad [1K]3 years ago
5 0

Answer:

The planet moves faster when closer to the Sun and slower when it is far from it

Explanation:

The law of planetary motion that answers to this question is the 2nd Kepler's law, which states that:

"A line connecting the centre of the Sun to the centre of each planet sweeps out equal areas in equal time intervals"

In order to understand what are the consequence of this law to the orbital velocity of each planet, we have to keep in mind that planets have an elliptical orbit, with the Sun occupying one of the two focii (Kepler's 1st law).

As a result, the planet at some point of the orbit is farther from the Sun, while at some point is closer to it.

Given to Kepler's second law, this means that when the planet is farther, the orbital velocity must be lower (because the line connecting the planet to the Sun is longer, so it can cover the  same area moving less), while when the planet is closer to the Sun, the orbital velocity must be higher (because the line connecting the planet to the Sun is shorter, so it will cover less area if moving at the same speed.

You might be interested in
Match each of the leg muscles with the correct label.
g100num [7]

Answer:

For the Numbers on the leg Photo

1. Rectus Femoris

2. Vastus lateralis

3. Tibialis Anterior

4. ADDuctor longus

5. Gracilis

6. Satorius

7. Vastus Medialis

8. Gluteus Medius

9. Gluteus Maximus

10. Semitendinosis

11. Semimembranosus

12. Biceps Femoris

13. Gastrocnemius  

Explanation: is correct

4 0
2 years ago
Hey yall you don't know me but can someone help ill do anything ​
marishachu [46]

Answer:

B ong

Explanation:

still required to do 20 characters but its B ong

5 0
3 years ago
The vocal cords stretch across the opening of the larynx. True or false??
Len [333]

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

6 0
3 years ago
Read 2 more answers
Why are autotrophs the most important organisms on the planet?
ELEN [110]

Answer:

They help our ecosystems and food chains all over the world

Explanation:

Autotrophs are the most important organisms on the planet because they are fundamental to food chains all over the world. They take energy from the environment in the form of sunlight or inorganic chemicals and use it to create fuel molecules like carbohydrates to release the hydrogen atoms that fuel the metabolic process of primary production.

<em>Explanation is in the paragraph above. Hope that helps!</em>

8 0
3 years ago
Read 2 more answers
The salinas River empties into the Pacific Ocean and cuts into the continental shelf, thereby forming which of the following fea
madreJ [45]
A . Guyot
Expanding yo mind!
8 0
3 years ago
Other questions:
  • What will happen to a flower garden over time If it’s left unattended
    8·2 answers
  • Please help only 3 question
    8·2 answers
  • The molecular basis of the Gram stain is the amount of _______ in the bacterial cell wall. bacteriophage spirochete peptidoglyca
    13·1 answer
  • What are the two major characteristics that change when air is heated and cooled?
    11·1 answer
  • Explain why the tongue can be considered the muscle with the greatest strength endurance.
    15·2 answers
  • What kinds of home pollutions are there
    8·1 answer
  • Because the interior of the lipid bilayer contains the nonpolar _______________, only small nonpolar substances are able to diff
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which SI (metric) unit would be used to measure the distance a turtle traveled across the beach?
    13·1 answer
  • What term is defined as the ability of a test to detect small concentration of an antigen or antibody?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!