1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
6

In Figure 8–4, why might the candle in jar A burn longer than the candle in jar B?

Biology
1 answer:
castortr0y [4]3 years ago
5 0
Need a picture!!
so send me one then I'll answer your question!!!!
You might be interested in
A man with type A blood whose mother was type O is married to a woman with type AB blood. What are the blood types of their chil
zhenek [66]

Answer:

possible blood type

A. 50%

B. 12.5%

AB. 37.5%

:)

6 0
2 years ago
What experimental evidence supports the model of metallic bonding?
Yanka [14]
Metals conduct electricity and heat, indicating that the electrons are free to move. Metals are malleable, showing that atoms are not in fixed positions but can remain bonded even though they change their positions. In metallic bonding, atoms donate electrons to a pool and all the atoms share in the pool. No compounds are formed, but the atoms are bonded into a network.
5 0
2 years ago
The populations of which organisms will most likely increase as a result of a disease that suddenly reduced the population of Te
kirill115 [55]

Answer:

G

Explanation:

It just is

8 0
3 years ago
A student is asked to describe the path of a paper airplane that is thrown
irga5000 [103]

it's cururururuvy it curves up and then down

4 0
2 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Other questions:
  • Water moves downstream because of a gradient in which of the following?
    8·1 answer
  • Someone help me !!!! will up vote
    5·1 answer
  • On which continent were fossils of both Glossopteris and Lystrosaurus discovered?
    15·2 answers
  • What biological macromolecule is made up of monomers like the one shown below?
    11·2 answers
  • Who came up with the theory of perfection
    8·2 answers
  • 2.3.4 Quiz: DNA Technology
    5·1 answer
  • What are at least 3 things that are not a lipid?
    14·2 answers
  • 6 Question
    15·1 answer
  • Enter an algebraic equation for the word sentence. Use x as your variable.
    9·1 answer
  • And
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!