1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
7

What's going on in the photo?

Biology
1 answer:
Margarita [4]3 years ago
4 0

Answer:

This is the lytic cycle.

Explanation:

The lytic cycle is one of the two cycles of viral reproduction, the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane. Bacteriophages that only use the lytic cycle are called virulent phages. It is a type of viral reproduction.

Hope this helps!

You might be interested in
Nutrients deposited on leaves as dust and materials leached from leaves through insect action are most often transported to the
postnew [5]
The appropriate answer is B. Throughfall. These nutrients are transported via the process of throughfall where rain flows from leaves to the ground. Rainforests receive high annual rainfall. The leaves are also designed to funnel water to the ground soon after a shower. Leaves are equipped with drip tips to allow water to roll of leaves easily. Any particles deposited on leaves are going to be washed to the forest floor by frequent rainfall that occurs here.   
5 0
3 years ago
Read 2 more answers
What is loveand it's causes​
AnnyKZ [126]
When you first fall in love, you experience a rush of hormones to the brain — including oxytocin, the “love hormone,” the “pleasure hormone” dopamine, and sex hormones like estrogen and testosterone. ... This influx of hormones plays a major role in those intense feelings of fluttery excitement, attraction and euphoria.
5 0
3 years ago
Read 2 more answers
Explain how the fossil record indicates a long history of<br> changing life forms.
LuckyWell [14K]

The fossil record essentially keeps track of the abundance and appearance of various fossils during different time periods. As time goes on, the fossils change. Using the fossil record, we can compare and contrast the fossils to develop theories about changing life forms and their connection to time.

Hope this helped :)

8 0
3 years ago
Read 2 more answers
What is the species name of a cat?
NISA [10]

Answer: Scientific name: Felis catus.

Explanation: I hope this helps :p

7 0
3 years ago
Read 2 more answers
What type of cell is more likely to replicate and replicate faster brain cell or hair cell
Nata [24]

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

4 0
2 years ago
Other questions:
  • Asexual reproduction creates offspring ______ the parent.
    10·1 answer
  • Which events take place in the light-dependent reactions of photosynthesis?
    7·2 answers
  • A group of rock layers contain similar fossils of similar age is called a
    10·1 answer
  • Where does mechanical breakdown of food occurs?
    11·1 answer
  • The study of matter and chemical reactions in the body is known as
    9·1 answer
  • Does anybody know the spesific island within the galapagos islands the marine iguanas inhabit?
    15·2 answers
  • What is the role of energy in living Organisms? Is it a more or less important role than other characteristics of life? Defend y
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Minerals are generally<br> a)solids<br> b)liquids<br> c)gases<br> d)plasmas
    12·2 answers
  • The process of __________ generates the oxygen that we breathe and the food that we eat. view available hint(s)for part a photos
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!