1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Misha Larkins [42]
3 years ago
6

How much carbon dioxide emissions from human activities is absorbed by carbon sinks? A.75%

Biology
1 answer:
Nikitich [7]3 years ago
7 0
I’m pretty sure it’s b.50%
You might be interested in
HELP QUICK-Which of the following is true regarding the atoms involved in a chemical reaction?
NeTakaya

Answer:

The same number of each type of atom will always be present before and after a chemical reaction takes place.

Explanation:

8 0
3 years ago
Animals and plants have cells that are specialized by the process of _____
wariber [46]
By the process of cell differentation
5 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
If two parents are contributing genetic material to their offspring, why don’t the genes and chromosomes double in each generati
igor_vitrenko [27]
Because you only get generic material from each parent, 23 from each adding up to 46
3 0
3 years ago
When describing the process of fertilization, the nurse would explain that it normally occurs in which structure?
sineoko [7]
The sperm and egg begin fertilization by meeting up and joijmning in the Fallopian Tubes.
5 0
4 years ago
Other questions:
  • What method by cell is use to move large solid?
    6·1 answer
  • The brain of a person with alzheimer's disease shows excessive amounts of
    15·2 answers
  • Fossil evidence shows that structures considered vestigial in living organisms
    10·1 answer
  • Why is it important to get enough iron in your diet
    12·1 answer
  • Which of the following best explains why the number of organisms at each level decreases while moving up the energy pyramid?
    11·1 answer
  • A spectacular marine animal has a network of glassy spicules that forms a sac-like structure. This animal does not have true tis
    7·1 answer
  • A woman exerts 100n of force to lift a laundry basket weighing 75 n show work
    9·1 answer
  • HELP PLZZ?!
    5·2 answers
  • The process that starts with dna and ends with 2 dna is called
    8·1 answer
  • In the context of the pathways in the nervous system, afferent nerves carry information Group of answer choices to the brain and
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!