1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
8

A toy car is placed at 0 on a number line. It moves 9 cm to the left, then 4 cm to the right, and then 6 cm to the left. What is

the total distance the toy car traveled? 1 cm 5 cm 11 cm 19 cm
Biology
2 answers:
Svet_ta [14]3 years ago
4 0

Answer:

19 cm

Explanation:

sup y'all i diz that quiz

balandron [24]3 years ago
3 0

Answer:

19 cm

Explanation:

The total distance traveled by the toy cay would be 19 cm.

<em>The total distance traveled should not be mistaken for total displacement. </em><u><em>W</em></u><u>hile displacement measures the distance and direction from the starting position of the toy car relative to its final position, the total distance traveled is calculated by adding all the movements of the toy car together.</u> Hence;

Total distance traveled = 9 + 4 + 6 = 19 cm

You might be interested in
Carbohydrates are a huge source of...
RSB [31]

Answer:

fast

Explanation:

Carbohydrates are huge sourve of fast energy

wish its right

5 0
3 years ago
One of the most common causes of acute tubular necrosis (ATN) is:________.
Tcecarenko [31]

Answer:

a. ischemic conditions.

Explanation:

Hello,

In this case, considering that acute tubular necrosis (ATN) has been widely acknowledged as a harmful medical condition showing off the death of tubular epithelial cells that give the form to the renal tubules of the kidneys; it presents with acute kidney injury. Thus, common causes of ATN include low blood pressure and use of nephrotoxic drugs which is more technically known as a. ischemic conditions in which the blood flow is very weak.

Regards.

8 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What is the rapid change in a membrane's potential caused by the depolarization of a neuron?
fgiga [73]

Answer:c it’s the answer

Explanation:

C

5 0
3 years ago
Which organisms store some of the molecules from food in their bodies 15 points
Allisa [31]

Not sure but i think its plants

6 0
3 years ago
Other questions:
  • What is the most important action for all students to take to stay safe in a science lab?
    5·2 answers
  • In some ecosystems, mountain lions eat deer, coyotes, and rabbits. Which of the following terms best describes these mountain li
    8·1 answer
  • Volcanic ash and sulfur dioxide spewed out of Mt. Pinatubo in 1991. These materials can reflect incoming solar radiation. Over t
    13·1 answer
  • The absorption and distribution of materials within an organism is a life function known as
    15·1 answer
  • Which best compares Radiation and Conduction? Check all that apply.
    15·2 answers
  • Will a clownfish, from the ocean be able to live in fresh water? Ik betafish can but its graded soo help plz​
    13·1 answer
  • 8. Although vaccines cannot be used to treat a person who is sick, they can help to prevent
    6·2 answers
  • Which season would earth be experiencing in the north hemisphere
    11·1 answer
  • How does artificial selection change a population over time?
    15·2 answers
  • What causes Swollen Shoot Disease?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!