1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
9

PLZ HURRY IT'S URGENT!!!!

Biology
2 answers:
attashe74 [19]3 years ago
7 0

D. The force is equal and in the opposite direction

Newton's third law states that every action has an equal and opposite reaction

lions [1.4K]3 years ago
5 0

The awnser for this problem is b. Hope this helps :) i took the quiz btw

You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
The chart below shows data from butterfly populations over a four-year period. Use the data in the chart to answer the question
Ber [7]

Answer:

red

Explanation:

       

6 0
3 years ago
Which of the following provides the best description of the function of genes?
AfilCa [17]

Answer: B i believe

Explanation:

7 0
3 years ago
Read 2 more answers
Write down the three characteristic features of human blood
Leokris [45]

  • Blood is a fluid that is technically considered a connective tissue.
  • It is an extracellular matrix in which blood cells are suspended in plasma.
  • It normally has a pH of about 7.4 and is slightly denser and more viscous than water
7 0
3 years ago
Will give Brainliest!
Rudiy27
The answer is (C) {mercury} hopefully someone else comments so I can get brainless.
4 0
3 years ago
Read 2 more answers
Other questions:
  • A scientific theory _____.
    6·1 answer
  • Which of the following factors is least influential in affecting the biodiversity of wetlands?
    6·2 answers
  • The spindle apparatus disintegrates during anaphase. true. false
    5·2 answers
  • Which would prevent a plant from growing?
    12·1 answer
  • The producers at the beginning of Earth's food chain are _____
    10·1 answer
  • Would a muscle cell be able to produce a functional contraction if it lacked t-tubules?
    15·1 answer
  • Lori-an has recently lost a lot of weight. she is now unhealthily skinny. she is concerned by this, and has gone to see her doct
    15·1 answer
  • Which step of cellular respiration do all organisms use
    9·1 answer
  • Please help I will mark branlist
    10·2 answers
  • HELP ASAP
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!