1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
exis [7]
4 years ago
7

What is the study of the barometric pressure of the atmosphere in Florida

Biology
1 answer:
Alenkinab [10]4 years ago
5 0
It would be Meteorology!!!!!1
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which of these is not an internal factor in causing cancer?
zubka84 [21]
The answer to this is inherited mutation.

Inherited mutation is a permanent alteration in the DNA sequence that makes up a gene, such that the sequence differs from what is found in most people.

Hope this helped :)
Have a great day
3 0
3 years ago
Which type of radiation from the Sun has the greatest potential to harm human skin?
jarptica [38.1K]
D.) Ultra Violet /UV rays
8 0
3 years ago
The emergency response guidebook (erg) is most effective during the first __________ minutes of an incident.
Klio2033 [76]
0 minutes. In order to prepare for an incident, an emergency response guidebook needs to be studied and used before an incident occurs. During a critical incident there is no time to be constantly consulting a guide, but rather should be inherent knowledge that is practiced and reviewed frequently. This may include engaging in discussions, on-going in the job training and role-plays with peer or colleagues. The ERG is a resource to learn from and refer to, but not in times of a critical incident.
8 0
4 years ago
Explain how the chemical properties of water affect the solubility of inorganic and organic molecules and how is this so importa
Delvig [45]

Explanation:

Water molecules are polar, meaning they have dipole polarities. The Hydrogen end is partially positive while the Oxygen end is partially negative. This is due to the fact that oxygen has a higher atomic mass and hence attracts most of the electron cloud of the molecule towards its end.

This property of water is very important because it is able to dissolve polar molecules while non-polar molecules do not dissolve. This is an important property in the body of organisms because, for example, water helps in the folding of proteins (by interacting with polar motifs of a protein) hence ensuring the protein maintains their functional structural forms.

Water also dissolves significant polar molecules that are utilized by the body, such as glucose, and helps in their transportation within the body. Water is also significant in the diffusion of hormones used in cell signaling, e.t.c.  

Water is also able to dissociate ionic compounds, such as sodium chloride, that are important in the osmotic pressure homeostasis of cells.

Learn More:

For more on chemical properties of water check out;

brainly.com/question/2047192

brainly.com/question/11083789

#LearnWithBrainly

8 0
3 years ago
Other questions:
  • what happens at the end of the chain in figure 9.3?; a) 2 electrons combine with a proton and a molecule of nad���.; b) 2 electr
    15·1 answer
  • State how matter moves through the biosphere. State how energy moves through the biosphere. Explain each statement using example
    15·2 answers
  • The earliest elephants evolved during the: Paleocene Eocene Oligocene Holocene
    8·2 answers
  • Two methods that are used to determine if an infant can see are _____ and _____
    12·1 answer
  • A biome is a large group of plants and animals living together in a specific _____. habitat population community climate
    12·2 answers
  • The cells on your fingertips are exposed to friction every time you touch something. thus, you can surmise that the fingertips a
    8·1 answer
  • HELP ME PLEASE Question 15 of 34
    6·1 answer
  • What is the columbian exchange?
    12·1 answer
  • How is a Cell like a School??
    5·2 answers
  • True or false <br> the chromosomes of the body cells are paired?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!