1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
8

What is the y-axis of this chart

Biology
1 answer:
borishaifa [10]3 years ago
8 0

Answer:

In this case, the temperature is supposed to go in the y-axis whereas the rates are on the x-axis.

You might be interested in
What substances do you think cells have to move into a cell daily in order for that
irina [24]

Answer:

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ). Diffusion is one principle method of movement of substances within cells, as well as the method for essential small molecules to cross the cell membrane.

6 0
3 years ago
What are the different types of interactions in nature?
arlik [135]
Mutualism and commensalism
6 0
3 years ago
A plant with two dominant OR two recessive alleles is said to be
Tems11 [23]

Answer:

Homozygous

Explanation:

Homo - Same/ zygous - same alleles

7 0
4 years ago
8. DNA is a major constituent of which cell organelle?
Y_Kistochka [10]

Answer:

chromosome in the nucleus

Explanation:

7 0
2 years ago
Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGC
Verizon [17]

Answer:

Explanation:

In the DNA, the nitrogen bases, Adenine A (a purine) forms double bond with Thymine T (a pyrimidine) but in RNA, the bond is with Uracil U (a pyrimidine) instead of Thymine; Guanine G (a purine) forms triple bond with Cytosine C (a pyrimidine): this also occur in RNA. This we have:

DNA sequence: 5' ATGCGTAGCCTAGCCTAGTAGCCTTC 3'

Complimentary strand : 3' TACGCATCGGATCGGATCATCGGAAG 5'

The RNA sequence is produced running from the 5' to the 3' direction thus, the complimentary strange will be used.

5'AUGCGUAGCCUAGCCUAGUAGCCUUC 3'

4 0
4 years ago
Other questions:
  • During the early stages of meiosis, two chromosomes in a homologous pair may exchange segments, producing genetic variation in s
    8·2 answers
  • Give examples of minerals that exhibit each of the six main crystal systems?
    13·1 answer
  • Is paper a renewable source
    10·2 answers
  • The second stage of the dark reaction is
    7·1 answer
  • What is the monomer of carbohydrate?
    15·2 answers
  • Which correctly lists the three plates that border the Indo-Australian Plate
    5·2 answers
  • The government has a plan to limit the effects of deforestation. It involves planting new trees to replace some of the larger tr
    14·1 answer
  • An important similarity between photosynthesis and cellular respiration is that both processes??
    13·2 answers
  • Look at the energy pyramid shown in the lesson. Suppose a trout eats a smelt and then a human eats the trout. About how many of
    11·1 answer
  • In a healthy eukaryotic cell, the rate of DNA repair is typically equal to the rate of DNA mutation. When the rate of repair lag
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!