1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
15

Some autotrophic euglena species become ______ when light levels are low

Biology
2 answers:
kykrilka [37]3 years ago
7 0

Answer: Heterotrophic

Explanation:

Euglena are unicellular organism that can be both autotrophic and heterotrophic based on the intensity of light that is available to it.

It can act as an autotrophic organism when there is enough sunlight which helps in the process of photosynthesis.

In case there is low light intensity it becomes heterotrophic and obtains energy from other sources.

Alona [7]3 years ago
5 0
Heterotrophic.... this is the answer :3
You might be interested in
Archaeologists speak of domestication only when there is evidence that plants and animals show a _________ wild plants and anima
kvv77 [185]
Show a difference from wild plants and animals
8 0
4 years ago
In the taxonomic system, genus is a subdivision of family.<br> True<br> Оr<br> False
leva [86]

Answer:

✔

Explanation:

genus (pl. genera)

in the modern classification system, a subdivision of a family; includes one or more species of organisms

6 0
3 years ago
If a car weighing 1500 kg and a truck weighing 4,000 kg are both traveling at 55 mph, which one will take more force to stop?
Zarrin [17]
The Truck will take more force to stop the truck  moving at a speed of 55mph weighing 4000kg has alot more momentum and will require a force equal to its speed and mass to stop it therefore the truck is the most obvious answer hope this helped bud
3 0
3 years ago
Read 2 more answers
1
dmitriy555 [2]

Answer:

Air will become more humid

Explanation:

due to the cooling of the air

4 0
3 years ago
Read 2 more answers
The two strands of a dna molecule are held together by hydrogen bonds between the
ZanzabumX [31]

the answer is bases.

6 0
3 years ago
Other questions:
  • True or false: a hypothesis must start with i think<br><br><br><br><br>thx<br><br> sakuracherry
    10·1 answer
  • Some reflexes, like the rooting, sucking and grasping reflex, are theorized to exist because
    9·1 answer
  • Ozone hole refers to...?
    11·2 answers
  • Describe how parent cells become two daughter cells
    11·1 answer
  • Which type of muscle tissue has cylindrical cell with multiplie nuclei striated muscle and voluntary regulation?
    9·1 answer
  • What is a seismometer?
    11·2 answers
  • Help with science pleaseeeeeeeee
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Define taxon ? give some example of taxon at different hierarchical level<br>please answe de do​
    15·1 answer
  • Help ASAP, I need the right answer please.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!