1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
11

The process in which glucose is broken down and atp is made

Biology
1 answer:
AfilCa [17]3 years ago
3 0

The Answer is <u>Cellular Respiration </u>

<u />

You might be interested in
Nucleus is present in the animal cell
Sidana [21]

Answer:

Yes.

Explanation:

The nucleus is present in both animal and plant cells.

7 0
2 years ago
What are the stages in mitosis?
Alborosie
Metaphase, prophase, anaphase,and telophase.
5 0
3 years ago
Read 2 more answers
Which feature do prokaryotic and eukaryotic cells share?
Anastasy [175]
The correct option is B. 
Prokaryotic cells are primitive cells which have no true nucleus and membrane bound organelles while eukaryotic cells are cells that have true nucleus, membrane bound organelles and well defined structures and layouts. Although the two cells are quite different from each other, they share some similarities and one of this is cytoplasm. Cytoplasm is present in the interior compartments of both cells.
8 0
3 years ago
Read 2 more answers
If a pathogen on food got past saliva, which additional defenses in the first line of defense would the pathogen contact?
Step2247 [10]

Answer:

D

Explanation:

Lymphocytes are the second line of defence

First line of defence indiscriminately defends against all pathogens unlike secondary response which is targeted. First line of defence refers to the external body components like skin, secretions from the body in the alimentary canel

Mucus traps pathogens. Stomach acid kills pathogens

7 0
3 years ago
Read 2 more answers
Iced tea mix is stirred into water until it dissolves . which statements are true?
Ray Of Light [21]
A. because the iced tea mix dissolves in the water therefore it is a solvent <span />
6 0
3 years ago
Other questions:
  • Which of the following is true of chloroplasts?
    6·2 answers
  • Once an action potential reaches the end of the axon, how does the information usually get to the next neuron?
    11·1 answer
  • Explain how the structure of the capillary wall helps to allow the plasma out of the blood
    10·1 answer
  • You are looking through a microscope and see that a teraf has formed. which phase of meiosis is in the cell in?
    13·1 answer
  • The absence of ______ in the primitive atmosphere was essential to the origin of life on Earth.
    12·1 answer
  • What is Thomas Edisons feild of specialty
    13·2 answers
  • Which of the following statements is correct?
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • In order to support life a planet will need ...
    11·2 answers
  • All living organisms are composed of
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!