1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
4 years ago
8

Control of temperature endocrine activity and thirst are functions associated with the ________.

Biology
1 answer:
irinina [24]4 years ago
4 0
<span>the spinal and cranial nerves</span>
You might be interested in
Please answer because I'm dumb
dsp73

Answer: 1 is a, 2 is b, 3 is c, and 4 is d.

Explanation:

4 0
3 years ago
When the landmasses of the British Isles and Scandinavia are fitted together, mountain chains and rock types _____. form a nearl
neonofarm [45]

Answer:

form a nearly continuous belt

Explanation:

When the landmasses of the British Isles and Scandinavia are fitted together, mountain chains and rock types form a nearly continuous belt.

7 0
3 years ago
Read 2 more answers
Which of the following best describes one way electron microscopes and light microscopes differ in structure?
stepan [7]
ELECTRON MICROSCOPES USE A BEAM OF ELECTRONS INSTEAD OF LIGHT TO MAGNIFY IMAGES 
4 0
3 years ago
Cleo has a vegetable garden and wants to increase the amount of nitrogen in the soil. How can she most likely do this?
Valentin [98]

You can buy/use fertilizer products made specifically for the type of vegetable.

7 0
4 years ago
Read 2 more answers
Examine the two waves shown below. Which wave has a greater amplitude
alexandr1967 [171]

Answer:

"Wave A" has the most amplitude.

Explanation:

Amplitude is defined as "the maximum extent of a vibration or oscillation, measured from the position of equilibrium."

"Wave A" appears taller, extending outwards from its center more than "Wave B", so your answer would be "Wave A".

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which situation is an example of nonnative species introduction?
    10·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What are the two types of energy sources??
    12·2 answers
  • Which of the following is an example of the importance of biodiversity in a natural ecosystem?
    13·2 answers
  • What are the major sources of evidence for evolution how does each support the theory of evolution?
    13·1 answer
  • .Which is the correct order of the stages of mitosis during cell division
    8·1 answer
  • Local anesthetics, like lidocaine and novocaine, reduce the perception of pain by:__________. A. blocking transmission of impuls
    6·1 answer
  • ste Styles Editing А у А - Аа Aa A A ΑΑ' 1 H - 21 Paragraph board 19 Font 1 Styles 67 2 4 5 I Question 6: (1.5 marks) Ramond Com
    11·1 answer
  • When testing tonicity of red blood cells, if the solution became transparent after adding blood cells, you could assume:.
    10·1 answer
  • Termites share an endosymbiotic relationship with the protozoan that live in their gut. Which statements are true of this relati
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!