1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
8

Yeast can reproduce by _____, which is when daughter cells arise as an outgrowth of the parent cell.

Biology
1 answer:
Kaylis [27]3 years ago
5 0

Answer: Budding

Budding is a asexual mode of reproduction in unicellular simple organisms. In budding a small protuberance or outgrowth develops as daughter cell on the parent cell called as bud. The bud enlarged in size and gets detached from the parent organism and grows as a new organism.  

You might be interested in
You return from lunch to science class, and there are two clear liquids on your
MrMuchimi

Answer:

My best guess would be boil it!

4 0
3 years ago
Read 2 more answers
The average number of individuals of the same species per unit of area or volume at a given time is the
BabaBlast [244]
Huhhhhhhhhhhhhhhhhhhhhhhhh
3 0
2 years ago
If a cell is placed in an isotonic solution, water will ____?
eimsori [14]

Answer:

Water will move in and out of the cell equally

3 0
3 years ago
Read 2 more answers
You are testing whether temperature has an effect on the breaking point of rubber bands. You take one rubber band and put it in
prisoha [69]
Independent variable: Temperature 
Levels: Room temperature
Freezing point 0C
Boiling point 100C

Dependent variable: breaking point of rubber bands measured in certain amount of temperature
6 0
2 years ago
Explain ur own answer. <br>need​
Pepsi [2]

Answer:run over with ice to make sure hes okay

Explanation:

6 0
2 years ago
Other questions:
  • The most weathered and leached of all soils are the ________.
    15·1 answer
  • Milk production
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • In comparing stop-transfer and internal start-transfer sequences in proteins, it can be said that __________. In comparing stop-
    8·1 answer
  • Electricity produced by waterpower is ____.
    14·2 answers
  • Which organism is placed in the phylum Eukarya?
    11·1 answer
  • One of the main functions of active transport is to supply the cells the oxygen required for metabolism. True False
    9·1 answer
  • Describe the relationship between ADP and ATP. What does each molecule do? Where would you find each molecule? (Use either Photo
    12·1 answer
  • Multiple Choice
    12·2 answers
  • Discuss your thoughts on the overall lab design. Did it help you understand the concepts better, or did it raise more questions?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!