1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
14

10pts 5 stars and a thanks if right, 1 star if wrong

Biology
1 answer:
kondaur [170]3 years ago
4 0
Hey!
So for the first answer, neither Fungi or Bacteria contains the given protein.
For the second answer, I'm pretty sure that I think that Fungi can reproduce asexually or sexually, while Bacteria can only do it asexually.
For the fourth answer, bacteria can be both, but fungi scavenges nutrients from dead organic material.
That leaves answer three, which is true.

I hope this helped! I'm sorry if I'm wrong.

Toodles~

You might be interested in
The elements or compounds that enter into a chemical reaction are called?
devlian [24]
The answer to this would be reactants.
6 0
3 years ago
Choose the equation that represents an exponential function that passes through the point (2, 36).
Alla [95]
Since we were given only one point, we have to test each exponential function for the point (2,36).

Since exponential functions are of the form y=n(a)^{kx}, The correct option is between option A and option C.

For option A,

f(x)=4(3)^{x}

On substitution, we have;

36=4(3)^{2}

\Rightarrow 36=4\times 9

\Rightarrow 36=36.

Since the point satisfied the exponential function f(x)=4(3)^{x}, the exponential function goes through it.

Hence the correct answer is option A.

No need to test for option C again.
4 0
3 years ago
Read 2 more answers
Would you except to find muscle tissue in a plant?Why or why not?
kirza4 [7]

Answer:

No, Because muscle tissue is on found inside humans and animals.

5 0
3 years ago
NEED HELP QUICK PLEASE HELP
kozerog [31]

Answer:

Question 1

D

Question 2

C

Question 3

D

Explanation:

1. An ecosystem is MOST likely to return to its original condition after Tall prairie grass burns after being struck by lightning.

Here is a research paper in which they explained how this happened. (Komarek, E. V. (1971). Lightning and fire ecology in Africa. In Tall Timbers Fire Ecology Conference (Vol. 11, pp. 473-509).)

2. In some national parks, controlled fires are maintained by firefighters. The major reasons for using controlled burns to maintain certain ecosystems is to give nonnative plants a chance to colonize the region.

A recent article provided the insight of this situation (Xanthopoulos, G., Delogu, G. M., Leone, V., Correia, F. J., & Magalhães, C. G. (2020). Firefighting approaches and extreme wildfires. In Extreme Wildfire Events and Disasters (pp. 117-132). Elsevier.)

3. One reason for the change in the Galápagos ecosystem has been the introduction of species that were not on the island before, such as donkeys, goats, cats, dogs, and insects. The introduction of nonnative species MOST likely disrupt the balance of life on the islands due to greater competition for limited food sources.

Scientist said that food competition is actually a struggle to survive in any ecosystem here is the reference paper (Eckhardt, R. C. (1972). Introduced plants and animals in the Galapagos Islands. Bioscience, 22(10), 585-590.)

5 0
3 years ago
The following table describes five molecules that belong to the same class.
Evgen [1.6K]

Answer:

B

Explanation:

proteins are used to repair muscle and make it stronger.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Energy efficiency is usually obtained through _______. The answer is B, Technology. Someone comment and I'll make them brainlies
    5·2 answers
  • Does a virus grow or not
    7·2 answers
  • The Calvin cycle of photosynthesis begins when
    13·1 answer
  • Suggest 2 ways of preventing the thermal pollution and still have the industrial development occur
    14·1 answer
  • Photosynthetic (autotrophic) protistans include all of the following except?
    7·1 answer
  • What happens to the molecules of a substance when heat is added to it ?
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Pls help me i really need help as fast as possible 50 pts!!!!!!!!!!
    9·1 answer
  • How does bacteria evolve?
    5·1 answer
  • What is the orbital radius (in AU) of Neptune if its period is 163.78 Earth years?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!