1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
4 years ago
5

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the ou

tcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.
Biology
1 answer:
horsena [70]4 years ago
7 0

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

You might be interested in
What changes were most likely caused by a shift in earth's continents?
Blizzard [7]

Answer:

The earth’s crust is broken into separate pieces called tectonic plates (Fig. 7.14). Recall that the crust is the solid, rocky, outer shell of the planet. It is composed of two distinctly different types of material: the less-dense continental crust and the more-dense oceanic crust. Both types of crust rest atop solid, upper mantle material. The upper mantle, in turn, floats on a denser layer of lower mantle that is much like thick molten tar.

Each tectonic plate is free-floating and can move independently. Earthquakes and volcanoes are the direct result of the movement of tectonic plates at fault lines. The term fault is used to describe the boundary between tectonic plates. Most of the earthquakes and volcanoes around the Pacific ocean basin—a pattern known as the “ring of fire”—are due to the movement of tectonic plates in this region. Other observable results of short-term plate movement include the gradual widening of the Great Rift lakes in eastern Africa and the rising of the Himalayan Mountain range. The motion of plates can be described in four general patterns:

<p><strong>Fig 7.15.</strong> Diagram of the motion of plates</p>

Collision: when two continental plates are shoved together

Subduction: when one plate plunges beneath another (Fig. 7.15)

Spreading: when two plates are pushed apart (Fig. 7.15)

Transform faulting: when two plates slide past each othe

Explanation:

7 0
3 years ago
The earths interior heat and pressure drivedl a proccess of heat transfers in the mantle called
Sergeeva-Olga [200]

Mantle convection describes the movement of the mantle as it transfers heat from the white-hot core to the brittle lithosphere. ... Convection currents also transfer denser, cooler material from the crust to Earth's interior through the process of subduction.Aug 11, 2015

4 0
4 years ago
Fungi are being used to kill gypsy moths.<br> a. True<br> b. False
Assoli18 [71]
The answer is a. True
8 0
3 years ago
The instrument that measures rate of transpiration a plant is called a ________.​
Zielflug [23.3K]

Answer:

Ans:

Potetometer

hope this helps u :)

6 0
3 years ago
Why are seasons important?
pickupchik [31]
If we had the same climate every minute of every hour tons of carbon would circulate the earth and climate change would make the polar ice caps melt from all the carbon around
5 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how co-evolution can lead to symbiosis
    13·1 answer
  • A crop grown to sell on the world market
    14·1 answer
  • According to the phylogeny tree, which phylum of organisms are most closely related to chordates?
    13·1 answer
  • Explain 2 important differences between the structure of dna and the structure of rna.
    8·1 answer
  • What do aerobic and anaerobic exercises have in common?
    5·2 answers
  • A common finding in markedly obese and pregnant women is:
    8·2 answers
  • When watering her plants, Stela adds enough water to the soil to completely wet it. How will this help in plant growth?
    5·1 answer
  • What are some services give me like 5 .
    7·2 answers
  • Which of the following is the most like the Biblical concept of grace:
    5·1 answer
  • The image below is an example of
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!