1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
11

In the treatment of coronary artery disease (CAD), medications are often ordered to control blood pressure in the client. Which

of the following is a primary purpose of using beta-adrenergic blockers in the nursing management of CAD?
Biology
1 answer:
Kaylis [27]3 years ago
8 0

Answer:

To decrease workload of the heart .

Explanation:

These blockers are used in the treatment of CAD to decrease the myocardial oxygen by reducing heart rate and workload of the heart.

Nitrates are used for vasodilation.

Anti-lipid drugs are used to decrease homocysteine levels.

ACE inhibitors inhibit the conversion of angiotensin.

You might be interested in
Is a person's DNA likely to be more similar to the DNA of his or her biological parents or to the DNA of one of his or her first
Gala2k [10]

Answer:

It's more likely to be similar to their parents,

Explanation: Due to the fact that the combined DNA of the parents helps decide what the offspring looks like, sounds like, what diseases they get & how their body functions. it's highly unlikely for it to be similar to one of the first cousins due to the fact that their mum/dad probably didnt mate with the mum/dad of the first cousin.

6 0
3 years ago
What initially causes a nerve impulse? release of enzymes out of the neuron movement of chemicals into the dendrites of the neur
sergeinik [125]

Answer:

movement of chemicals into the dendrites of the neuron

Explanation:

Nerve impulse occurs when electrical gradient is moved across the plasma membrane of a resting neuron this is done when the neuron receives a chemical signal from another cell or some other type of stimulus. This action potential then travels down the neuron’s axon as an electric current.

Resting potential occurs because of the difference in electrical charge across the plasma membrane of a neuron.

An electrical gradient is maintained by the sodium-potassium pump this is done across the plasma membrane of a neuron when it is not transmitting a nerve impulse this is the resting potential of the neuron.

8 0
3 years ago
Read 2 more answers
How does an amoeba move from one place to another​
Finger [1]

Answer:

<em>Amoebas move by using bulging parts called pseudopodia</em>

<em>sorry</em><em> </em>

5 0
3 years ago
Read 2 more answers
Identify the term used to describe a cell that goes through interphase, mitosis and cytokinesis.
KengaRu [80]
The answer is cell reproduction
3 0
4 years ago
Carbohydrate digestion begins in the _______________. select one:
attashe74 [19]
Carbohydrate digestion begins in the mouth<span>.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • During photosynthesis, plants, algae, and certain bacteria remove ___ from the air and fix it into chemical compounds.
    6·1 answer
  • Scientific name for rice is
    7·1 answer
  • Process by which a single parent reproduces by itself.
    15·1 answer
  • Which is an abiotic factor of a marine ecosystem
    5·1 answer
  • Bones provide both structure and protection for the body.<br> a. True<br> b. False
    10·2 answers
  • Is hyponatremia a result of osmosis or active transport and why?
    13·1 answer
  • What is the difference between a density-dependent and density-independent limiting factor?
    14·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • When ice freezes, the water around it becomes saltier and colder. _______, it's density increases.
    14·1 answer
  • PLEASE WRITE IN OWN WORDS, HELP!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!