1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
12

what is the function of vesicles in the synthesis of proteins and the release of those proteins outside the cell

Biology
1 answer:
miss Akunina [59]3 years ago
8 0

The purpose of vesicles is simply water retention

You might be interested in
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
drek231 [11]

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



5 0
3 years ago
How does a convection current transport energy around the globe
Helen [10]
The ocean around the globe gets heated up due to the heat around the sun. This hot water is then passed through to the colder regions of the globe by the method of convection. This is a continuous process.
4 0
4 years ago
How does the immune system work with other body systems to protect the body from pathogens?
Nesterboy [21]

Answer:

integumentery system

Explanation:

your skin is actually the first protection against illness-causing pathogens.

6 0
3 years ago
Read 2 more answers
Give an example of where you could find the three classes of lipids (triglycerides, steroid, and phospholipid) in living organis
hjlf

Answer:   Types of lipids include triglycerides, phospholipids, and steroids. Each type has different functions in living things.

Explanation:

7 0
3 years ago
What type of cells does a mushroom have?​
zubka84 [21]

A mushroom is a plant, therefore the cell that it has that is different from animal cells would be chloroplasts. However, mushroom also have a specific cells called "fungal cells" which can only be found in mushrooms and fungus.

May I have brainliest please? :)

4 0
3 years ago
Other questions:
  • Where are your genes found?
    9·2 answers
  • What property of light waves explains the appearance of the pencil under water?
    11·2 answers
  • THE TEMPERTURE VARY FROM THE MEAN
    6·1 answer
  • The larval forms of a tapeworm are known as ________.
    9·1 answer
  • What are two examples of a cell utilizing cytosis?
    5·1 answer
  • Why does the twilight zone of the ocean have the greatest variation in temperature?
    11·1 answer
  • A student is taking an animal science and an astronomy class. In animal sciences, she learns that pumas are called mountain lion
    5·2 answers
  • I WILL GIVE BRAINLIEST Using the information above and details from your research, write a paragraph of five sentences or more e
    10·1 answer
  • How does smoking cause bladder cancer? Write a concise answer to this question using scientific language effectively
    12·1 answer
  • Imagine you are designing a movie or video game monster based off of the tongue-eating isopod. Describe how you would translate
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!