Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
bananas is the answer because there good
Conception- This is when the egg and the sperm unite at conception, it is the fertilization and starts at the woman’s fallopian and the fertilized egg , First Trimester
- First four weeks of the conception-, Second Trimester- This is 3 months after conception and this is where the baby can be felt kicking and can hear,Third Trimester- 28 weeks after conception and is having breathing movements and the women would be adding some body fat. If I am wrong please let me know
