1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
4 years ago
7

The heart is the major organ in the circulatory system. Which region of the heart supplies oxygenated blood to the aorta?

Biology
2 answers:
aev [14]4 years ago
5 0
The LEFT VENTRICLE of the heart supplies oxygenated blood to the aorta.

Aorta is the main artery that supplies oxygenated blood from the heart to other organs and tissues (except lungs, lungs are for gas exchange instead) so that they get enough oxygen and nutrients.

Meanwhile, the heart has 4 chambers, left and right atrium, and left and right ventricles. Atrium are for receiving blood from different vessels, and ventricles are for pumping blood out of the heart.

Since only the left ventricle is connected to the aorta, so, the answer should be left ventricle.

Reference picture by amac training.

krok68 [10]4 years ago
4 0

Answer:

The correct answer for Plato is the bottom right box... the left ventricle

Explanation:

You might be interested in
PLZ HELP!!! I'm timed. I need answer as soon as possible. Will mark the brainliest if correct and ad a thanks with a rate of 5 t
gregori [183]
Carbon dioxide! Hope I helped
5 0
4 years ago
Read 2 more answers
How do fossils of extinct species provide evidence of how life on earth has changed?
Snowcat [4.5K]
They show how all creatures have adapted such as giant dinosaurs are now tiny lizards =D<span />
8 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Give an example of each kingdom; provide the following things: cell type, cell structure, (anything unique in the cell wall, chl
nataly862011 [7]
Plantae: Autotrophic, Multi- or Monocellular, have cell walls as well as a membrane, have a chloroplast making the characteristic green color and to capture sunlight for photosynthesis. Break down generated glucose into it's components.

Animalia: Heterotrophic, Multi- or Monocellular, have a cell membrane made of a phospholipid bilayer, and many mitochondria to aid with movement energy. Feed on plants or other animals. Eukaryotic cells.

Fungi: Heterotrophic, most Multicellular, have a rigid cell wall made of chitin, specialized cells to aid with decomposition of dead organic matter. Eukaryotic cells.

Protista: Can be plant-like, animal-like, or fungus-like. Most are single-celled, may be chemosynthetic or photosynthetic. Eukaryotic cells.

Archeabacteria: Prokaryotic. Do not have nuclei or membrane-bound organelles. Move around using a flagellum to propel itself. Lives in mainly fluid environments (air, water). Separated from Eubacteria due to it's high tolerance of extreme conditions, such as high salinity, no oxygen, burning heat, or freezing cold. Can be chemosynthetic or anaerobic, as well as aerobic.

Eubacteria: Normal, everyday bacteria. Prokaryotic, chemosynthetic, anaerobic, or aerobic. Do not have nuclei or membrane-bound organelles. Mobile using a flagellum to propel itself.
7 0
3 years ago
Which domain do we belong to? what characteristics do we have that put us in this domain
Fantom [35]
Mammals? Is that what your asking
4 0
3 years ago
Read 2 more answers
Other questions:
  • Explain why this feedback loop does not apply to a person with untreated diabetes.
    11·1 answer
  • For dating what kinds of Geologic samples containing uranium is 238U most useful? Why?
    12·1 answer
  • Which is the best example of an autobiographical memory?
    12·1 answer
  • Which of the following statements is true about isotopes?
    8·1 answer
  • what is true of intercellular signals that do not go through direct connections between cells such as a gap junctions
    15·2 answers
  • What does evidence show about radial symmetry in invertebrates? a. all invertebrates with radial symmetry are closely related b.
    8·1 answer
  • WILL MARK YOU BRAINLIEST!
    9·2 answers
  • Another saying is that a chain is only as strong
    5·1 answer
  • I am able to fill a glass of water to the top and it does not overflow…which property of water allows this to happen
    12·2 answers
  • What is wrong with the following question? select all that apply "Is the sky Blue?"
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!