1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
12

Which end product of alcoholic fermentation is important in the baking industry?

Biology
1 answer:
Svetach [21]3 years ago
6 0
The products are ethanol and CO2. When you add yeast in your dough, the dough raises because the yeast produces CO2. 
You might be interested in
1. Which grouping in the animal kingdom is the only one that contains organisms with vertebrae?
harkovskaia [24]

Vertebrata

Vertebrata is a group that contains various organisms which possess vertebrae (backbones). Animals that belong to the group are called vertebrates, and they include mammals, birds, fish, amphibians, and reptiles. The backbones in the animals extends from the head to the tail, and it encloses and protects the main nerve cord. The body of vertebrates is divided into trunk, and tail regions. They also possess a unique tube shaped brain, a distinct head, and three pairs of sense organs.



8 0
2 years ago
Read 2 more answers
Why does the process of mass wasting occur faster on a steep slope?
Anuta_ua [19.1K]
The force of gravity causes mass wasting to occur faster.☺
6 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
The water table _____.
aksik [14]
Out of the choices given, the water rises and falls with precipitation. The water table is the level below where the ground gets saturated with water. The correct answer is B.
4 0
3 years ago
Read 2 more answers
How many atoms make up the head of a pin​
Sergio [31]

Answer:

About five million million hydrogen atoms could fit.

Explanation:

Hope it helps :)

8 0
3 years ago
Other questions:
  • a three letter sequence of mrna that encordes for a specific amino acid is called a/an a series of these links specific amino ac
    5·2 answers
  • Separation technique for sucrose and sugercane​
    12·1 answer
  • If the mass of a material is 80 grams and the volume of the material is 24 cm3 , what would the desitinty of the material be? Pl
    7·1 answer
  • HELP ME PLEASE IS URGENT
    8·2 answers
  • What counteract pressure that pushes and pulls at the side of a building during an earthquake
    9·1 answer
  • which substance is a waste that would normally diffuse across the placenta from the embryo to the mother?
    12·1 answer
  • You are choosing your favorite fresh vegetables at the grocery store when you are suddenly sprayed with a mist of water meant fo
    10·1 answer
  • A benefit of sexual reproduction over asexual reproduction is that sexual reproduction
    7·1 answer
  • True or false the enzyme maltese is secreted from the walls of the duodenum?​
    13·1 answer
  • What are chromoplasts and their functions? ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!