1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
3 years ago
8

Which fungi group is known as the zygote fungi and produces spores in zygosporangia? Ascomycota Basidiomycota Zygomycota Chytrid

iomycota
Biology
2 answers:
Molodets [167]3 years ago
7 0
Zygomycota, I think 

Hope this helps
Pani-rosa [81]3 years ago
3 0
The answer is C. Zygomycota have a good day
You might be interested in
Which statement best describes how the evolution of pesticide resistance occurs in a population of insects?
alex41 [277]

Answer:

D. A number of genetically resistant pesticide survivors reproduce. The next generation of insects contains more genes from the survivors than it does from susceptible individuals.

Explanation:

Insect populations already have some insects with pesticide resistance genes. Exposure of insects to pesticides results in the natural selection of these insects with pesticide resistance as they are able to survive and reproduce in the presence of pesticides whereas the other insects die. The resistant insects leave more progeny resulting in the evolution of insect population with increased frequency of pesticide resistance gene.

4 0
4 years ago
What is an example of weathering, erosion, and deposition in Texas? (A)Gradual change to Guadalupe Peak (B)All of the above (C)T
kogti [31]

Answer: Weathering, erosion, and deposition from the terrestrial surface topography and soil characteristics. These processes, for example, have formed a variety of landforms in Texas like beaches, plateaus, mountains, and canyons as well as soil types like fertile soil, clay-rich soil, and sandy soil. The combination of topography, soil, and climatic conditions in an area defines the types of habitats that the area can support this is crucial to ecoregion classification. Ten separate ecoregions occur in Texas including 1) East Texas Pineywoods, 2) Gulf Coast Prairies and Marshes, 3) Oak Woods and Prairies, 4) Blackland Prairie, 5) cross timbers and prairies (6) Rolling Plains, (7) High Plains, (8) TransPecos, (9) South Texas Plains, (Brush Country), and (10) Edwards Plateau. Such ecoregions are named for the major types of habitats topographical features (e.g. Edwards Plateau) present in their areas. The weathering, erosion, and deposition of each of these ecoregions have an important influence. Hope This Helps :)

5 0
3 years ago
Read 2 more answers
Why does incomplete dominance not support the blending theory of inheritance?
Nookie1986 [14]
Incomplete dominance can happen in flowers such as snap dragons where a red flower plant and a white flower plant have an offspring that is neither red nor white but is a mix so in this case it would be pink. It does not support the blending theory as it does not get its colour from the dominant plant in this case but from both.
5 0
3 years ago
A gene is a subunit of information on a chromosome.<br> True<br> False
diamong [38]
It is an absolutely true statement that a <span>gene is a subunit of information on a chromosome. The correct option among the two options that are given in the question is the first option. I hope that this is the answer that you were looking for and the answer has actually come to your desired help.</span>
5 0
3 years ago
Read 2 more answers
There are many factors that influence the number of different kinds of plants in a biome. Why is elevation, or height, a factor
igor_vitrenko [27]
Elevation can affect the amount of sunlight that plants receive, the amount of water that plants can absorb and the nutrients that are available in the soil. As a result, certain plants grow very well in high elevations, whereas others can only grow in middle or lower elevations.
5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of these statements would be true if the water molecule was linear instead of bent? Check all that apply.
    6·2 answers
  • Help me on problem 13 and 14
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • In which way does the lotka‒volterra predator‒prey model of population growth differ from the logistic model?
    12·1 answer
  • Which of the following is expected to increase due to change climate?
    7·1 answer
  • A biology book said that the structure of a cell is closely related to its function. Using both plant and animal examples, comme
    14·1 answer
  • There are many different types of touch receptors (hot, cold, etc.) in the skin, and these different types of receptors are not
    8·1 answer
  • Atom: The particle of an element
    15·1 answer
  • Growth hormone and insulin are protein hormones that regulate carbohydrate metabolism by hepatocytes (liver cells) through the a
    15·1 answer
  • Help me!!!! Please I have been stuck on this for like 1 hour.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!