1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
5

When an active cold front overtakes a warm front, _____.

Biology
2 answers:
denis-greek [22]3 years ago
7 0

Answer:

When an active cold front overtakes a warm front, an occluded front forms. An occluded front forms when a cold front overtakes a warm front, producing a complex weather pattern. When tow air masses meet, they form a front, which is a boundary that seperates two air masses.

Explanation:

dolphi86 [110]3 years ago
6 0
Occluded front I think this answer is correct
You might be interested in
Earth's outer core is made of_____.
inn [45]

Answer:

Liquid metal.

Tell me if wrong. :) Hope it helps!

Explanation:

7 0
3 years ago
Read 2 more answers
The relationship between the amount of energy available for use and the amount of entropy in a food chain differs between trophi
Anarel [89]
<span>B. energy is lost at each level as heat, which increases randomization
</span>
3 0
3 years ago
Read 2 more answers
Which is more appropriate?
Thepotemich [5.8K]

Answer:

A

Explanation:

The The one that is appropriate is A because phytoplankton to fish is like the bacteria that is on the bottom of the floor in the water and the fish could eat that phytoplankton and then your shark and whale could eat the fish and get the phytoplankton so your answer is A

6 0
4 years ago
When a person farts in a elevator and you smell it one minute later ...
Inessa05 [86]

Answer:diffusion

Explanation:

6 0
3 years ago
A researcher, studying dolphins in the wild, made the following sketch. Each dot on the map represents one dolphin. The area sur
Leviafan [203]
The answer is 21. Just do 3•7 and you get 21.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Hi harshika<br>answer fast​
    10·1 answer
  • Which of the following is a true statements about viruses?
    13·1 answer
  • Which of the following will produce<br> the most genetic diversity in<br> offspring?
    5·1 answer
  • 8. Unlike weather, climate
    13·2 answers
  • Amoebas are unicellular organisms, while human beings are multi-cellular and the most intelligent of organisms. However, both ar
    8·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • How is mitosis different in plant cells?
    11·1 answer
  • The area of soil in which the pores are totally filled with water is called the ____________________ zone.
    7·2 answers
  • Cellular respiration and photosynthesis are similar in that both require
    9·1 answer
  • What is the adaptation of the heart in human body?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!