1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
7

What happens to E. coli when lactose is not present?

Biology
1 answer:
AlexFokin [52]3 years ago
5 0
<span> LOOK up Negative Regulations E. Coil 
</span>
You might be interested in
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
For each levels of classification for an organism, describe what it is made up of and the relation to the functions.
svetoff [14.1K]

Answer:

Cells,tissues,organs,organ systems, organism

Explanation:

Linnaeus Taxonomy Includes ,Domains.Each domain subdivided into ,Kingdom ,Phylum ,Class ,Order ,Family.Genus and Species.

Domain Bacteria: Bacteria,Archaea.They are unicellular organism,asexual reproduction,Some are autotrophs but most of them are heterotrophs.

Domain Eukarya has four kingdoms: Animalia, Plantae, Fungi, and Protista. . They are classified based on  their cellular organization, their ability to obtain nutrients, and their mode of reproduction.

Kingdom Animalia: They are multicellular heterotrophs.Sexual reproduction,

Kingdom Plantae: It includes all plants and they are autotrophs. They.They make their own food .they are multicellular can reproduce sexually or asexually.

Download docx
4 0
3 years ago
How are viruses different from bacteria? A) Bacteria are heterotrophic while viruses are autotrophic. B) Bacteria are living org
vichka [17]
Answer - B

Bacteria are living cells whereas viruses are acellular and the research on them till now suggests that they are non-living organisms.
4 0
3 years ago
Read 2 more answers
EXPLAIN the difference(s) between a scientific theory and a scientific law. You may include examples to demonstrate/support your
lord [1]
A scientific theory explains the reason for the occurrence of phenomena. However, a scientific law is limited to applicability and does not give any explanation regarding the phenomena in which it can be applied to.
4 0
3 years ago
Read 2 more answers
Where does the water in lakes come from? Select the three correct answers.
baherus [9]
D: Surface-water runoff from rain
7 0
3 years ago
Read 2 more answers
Other questions:
  • A container is filled with 100mL of water and placed in a freezer. the water in the container freezes at 0°C.A second container
    7·1 answer
  • Explain why the process of mitosis is important to Eukaryotic organisms
    10·2 answers
  • What seems to be a major difference between a deciduous forest and a coniferous forest
    7·1 answer
  • The eggs released by sponges during reproduction have proteins on their surfaces that prevent sperm from different sponge specie
    6·1 answer
  • What is the composition of a DNA fragment?
    8·1 answer
  • What happens to the name of a hurricane if it is particularly
    11·1 answer
  • What are the protective function tissues in the human body?
    6·1 answer
  • Which of the following is a benefit of meiosis?
    11·1 answer
  • How was your day quetson
    10·1 answer
  • How healthy foods affect human blood pressure
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!