1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
14

Which scientist disproved the idea of spontaneous generation by formulating and testing the hypothesis that only flies can make

flies, and that rotting mean cannot be transformed into flies.
A) Charles Darwin


B) Lois Pasteur


C) Francesco Redi


D) Stanley Miller
Biology
2 answers:
____ [38]3 years ago
5 0

Answer:

The answer would be C, Francesco Redi

devlian [24]3 years ago
3 0
The correct answer is C, Francesco Redi, who in 1668 demonstrated that life originates from life and there is not the spontaneous generation of life from non-living things like meat. It was the first real experiment which disproved the theory of spontaneous generation. 
You might be interested in
What is photosensithesis?
harkovskaia [24]

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities.

5 0
2 years ago
Meiosis takes place in the ______ of most organisms.<br> -Gonads<br> -Heart<br> -Brain <br> -Skin
Elan Coil [88]
Meiosis takes place in the gonads of most organisms. 

So the correct answer is A : Gonads.

Hope this helps :)
~Davinia.
7 0
3 years ago
Read 2 more answers
What is oviary . explain briefly ​
Drupady [299]

Answer:

The ovaries are small, oval-shaped glands that are located on either side of the uterus.

3 0
2 years ago
Read 2 more answers
which type of macromolecule is a new drug most likely to be? A. a lipid B. a nucleic acid C. a protein D. a carbohydrate
PolarNik [594]

Answer:

i would go with b

Explanation:

3 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Why is blood obtained through veins and not from arteries when collecting blood?
    15·1 answer
  • Yellowstone National Park has an average of about 4500 bison living in it. The park covers 3472 square miles. What is the popula
    9·1 answer
  • 3 facts learned about genetics
    15·2 answers
  • Which attributes would allow a cell to be larger?
    5·2 answers
  • A forest is cut down to put a field of corn how will this affect the biodiversity of the area
    15·1 answer
  • 1. Ano-anong mga Likas na Yaman ang sagana sa Asya​
    6·1 answer
  • Say jesus without the je :&gt;
    9·2 answers
  • Can someone plz help me on this plz help me I’ll appreciate it
    5·2 answers
  • When the membrane is at the potassium equilibrium potential, in which direction (in or out) is there a net movement of potassium
    6·1 answer
  • Cytokines trigger endothelial cells to express specific receptors called _____ , which bind to _____ on the surface of neutrophi
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!