1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
3 years ago
7

What part of the femur articulates with the tibia to form the knee joint?

Biology
1 answer:
dybincka [34]3 years ago
6 0

<u>Answer:</u>

<em>The patella articulates with the tibia to form the knee joint. </em>

<u>Explanation:</u>

<em>Patella is called the knee cap and it gives protection to the knee.</em>  Femur is the longest bone in the body and has the function of supporting the weight of the body and enhancing the movement of the legs. <em>The knee joint permits the extension of the lower leg relative to the thigh. </em>

It allows a 120 degree movement unlike other joints that allow lesser freedom of movement. <em>Patella is the part of the femur that articulates with the tibia and forms the knee joint. </em>

You might be interested in
What do scientists use to mark boundaries in the geologic time scale?
tekilochka [14]

Era is used to mark the boundaries of geological time scale by using radio carbon dating technique.

Explanation:

Geological time starts with Precambrian time.

Geologically, time is divided between the Precambrian era and present time into era.

The three eras are Paleozoic era, Triassic period and Cenozoic era.

Era is further divided into periods.

Scientists use radio carbon dating to study fossils and rock formation. With this study they were able to divide them in exact geological scale.

Geologic scale is the record of events in earth's history and evolution.

3 0
3 years ago
The purpose of the right ventricle is to: receive blood coming back from the lungs pump blood to the upper and lower body pump b
s344n2d4d5 [400]
The right ventricle will pump blood into the lungs to be oxygenated bia the pulmonary artery.
6 0
2 years ago
9. Which of the following accurately describes the process of translation?
Zielflug [23.3K]

The process of translation involves each codon calls for a specific nucleotide. The answer is letter A. during translation, an mRNA sequence is read using the genetic code to be translated into the 20-letter code of amino acids.

8 0
3 years ago
A mutation changes the DNA sequence AAGCCTGGCAAT to the new sequence AAGCCTGGCAAT what kind of mutation has occured?
ziro4ka [17]
I would say C Duplication since both of the DNA sequences are identical.
5 0
3 years ago
Read 2 more answers
Did he discover about magnetism in the oceans crust?
e-lub [12.9K]
The crust is not magnetic near the ocean ridges
5 0
2 years ago
Other questions:
  • _ the volume of gas.
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How are gastrovascular cavity and digestive tract alike
    13·1 answer
  • What is the energy in the products of photosynthesis?
    5·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    13·1 answer
  • Which of these is least likely to be an adaptation?
    6·1 answer
  • Match the answer in the correct space <br><br> ⚠️please help me⚠️
    13·1 answer
  • A student is making a table to show the ways in which cell structures help to maintain homeostasis. Which cell structure
    11·1 answer
  • Describe the role of acetylcholinesterase in stimulation of a muscle fiber.
    12·1 answer
  • How does pollution threaten coral reefs? Answer using at least 3 complete sentences.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!