Cells synthesise a large number of different macromolecules required for life. The Golgi apparatus is integral in modifying, sorting, and packaging these substances for cell secretion (exocytosis) or for use within the cell. It primarily modifies proteins delivered from the rough endoplasmic reticulum, but is also involved in the transport of lipids around the cell, and the creation of lysosome.
<span>Enzymes within the cisternae are able to modify substances by the addition of carbohydrates (glycosylation) and phosphate (phosphorylation) to them. Proteins are also labelled with a signal sequence of molecules which determine their final destination. For example, the Golgi apparatus adds a mannose-6-phosphate label to proteins destined for lysosomes. </span>
<span>Vesicles which leave the rough endoplasmic reticulum are transported to the cis face of the Golgi apparatus, where they fuse with the Golgi membrane and empty their contents into the lumen. Once inside they are modified, sorted, and shipped towards their final destination. As such, the Golgi apparatus tends to be more prominent and numerous in cells synthesising and secreting many substances: plasma B cells, the antibody-secreting cells of the immune system, have prominent Golgi complexes. </span>
<span>Once the proteins reach the trans face, they are placed into coated transport vesicles and bud off to reach their final destinations. The form of the vesicle is determined by the type of protein and the label it acquired.</span>
the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'
the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand
so for reference heres a little cheat guide
Adenine=Thymine
Thymine=Adenine
Guanine=Cytosine
Cytosine=Guanine
a. urine volume will increase .
HOPE THIS HELPFUL
Answer:
none of these codons
Explanation:
In order for mutation to occur to form methionine codon from an isoleucine codon, position 3 must be changed to a G, giving AUG. A secind mutation would then be required at a second site in the AUG codon. since the isoleucine codons, AUA, AUC and AUU does not have a G at position 3, a true reversion can't occur without mutating the position 3 again.
Answer:
The correct answer is "True".
Explanation:
Some species of jellyfish use a form of jet propulsion to swim and get around the sea. For instance, the jellyfish <em>Polyorchis penicillatus</em> contracts its subumbrellar swimming muscles to gain power, which it uses as mechanical energy to perform a jet cycle while swimming. Some studies in this regard have been performed, measuring even the amount of energy needed in the muscles for the jellyfish to swim.
