1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
5

How does organismal behavior demonstrate an emergent property of an organism's physiology

Biology
1 answer:
OLEGan [10]3 years ago
3 0
An element property of an of an organism physiology can appear when a number of organisms is in the same environment. the behavior demonstrated by one may be mimicked or adopted by another.   

hope this helps XD
You might be interested in
Which of the following are physical geographic features? ​
antoniya [11.8K]
Can you please post option too
7 0
3 years ago
The continental crust and oceanic crust together make up the ________
Butoxors [25]
B is the answer?!? Sorry if im wront
5 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
What would happen if the aerobic respiration process broke down in a tropical rain forest?
igomit [66]
The right answer for the question that is being asked and shown above is that: Aerobic Respiration by definition is<span> the process of producing cellular energy involving oxygen. If </span><span>the aerobic respiration process broke down in a tropical rain forest, then the tropical rain forest cannot produce foods.</span>
5 0
3 years ago
After creating a hypothesis, what is the next step in Mary and Jim's investigation?
vovikov84 [41]

They'll have to do the following 2 stpes:

- Look for evidence that suports their conclusion

- Do tests in order to prove their hypothesis


Hope it helped,


BioTeacher101

8 0
2 years ago
Read 2 more answers
Other questions:
  • Water is an abiotic factor in terrestrial environments. true or false
    11·2 answers
  • During which phase of mitosis do the nuclear membrane, nucleolus, and nucleus dissolve?
    6·2 answers
  • 6.
    9·2 answers
  • Why don’t all molecules contain only single bonds
    9·1 answer
  • Aldosterone is synthesized from cholesterol. <br> a. True<br> b. False
    8·1 answer
  • Which individual is shown in karyotype
    13·1 answer
  • The purpose of DNA replication in the cell cycle?
    7·2 answers
  • True or False: Natural Selection is a random process, by which nature
    6·1 answer
  • How can beavers help dry areas? Fill in the inference in the chart.
    8·2 answers
  • Que son las lesiones musculares?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!