1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
4 years ago
14

Which statement best describes the relationship of photosynthesis and energy?

Biology
1 answer:
katovenus [111]4 years ago
3 0

Answer:

The answer is the second choice.

Explanation:

You might be interested in
What does catabolic mean?
pochemuha
Catabolism<span> (from Greek κάτω kato, "downward" and βάλλειν ballein, "to throw") is the set of metabolic pathways that breaks down molecules into smaller units that are either oxidized to release energy, or used in other anabolic reactions.</span>
8 0
3 years ago
Suppose that a surface impoundment site for hazardous waste is planned for your community. would you oppose locating the site in
svp [43]
I will vehemently oppose the location of any surface impoundment site in my community.
Hazardous wastes are not meant to be disposed in a community setting, such wastes should be taken to isolated locations that are not inhabited by any human. This is because hazardous wastes can have very dangerous effects on the health of the people that are living in a community. Such effects include: various kind of disease conditions, miscarriages, birth defects, blurred vision, dizziness, still births, etc.<span />
6 0
4 years ago
Read 2 more answers
HELLO ASAP ITS FOR A TEST
noname [10]

Answer:

the answer is U shaped valley

4 0
3 years ago
Read 2 more answers
Besides altering stomata, select three adaptations found in plants to reduce water loss.
abruzzese [7]

The stomata of many cacti lie deep in the plants' tissues. This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

C) thick waxy cuticle.

7 0
3 years ago
Karen bought a birdbath made of concrete. The salesman suggested that she seal
Cerrena [4.2K]

Answer:

Explanation:

If she doesn't the water will seep through the pores and the birds will get a bath only while the hose is on, in which case there is no reason for the birdbath.

8 0
3 years ago
Other questions:
  • Which characteristics must an object possess in order to be considered alive?
    12·1 answer
  • The terrestrial planets are characterized by having a ____? A.) silicate core B.) iron-rich silicate core C.) iron-rich metallic
    14·2 answers
  • Point-source pollution includes sewage treatment plants or an oil tanker that has leaked in a bay. True False
    9·2 answers
  • Under what conditions will normal cell division and growth most likely occur?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is required for both the light dependent and light independent reaction to proceed
    13·2 answers
  • The process by which cells become specialized in form and function during development is known as-
    5·1 answer
  • Which of the four pathogens is the most widespread and why?
    15·2 answers
  • Definition of germination<br>​
    11·1 answer
  • A boulder is pulled by a constant force of 15N at an angle of 30 degrees over a distance of 3 meters. What is the work done by t
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!