1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
3 years ago
6

A male body contains 5 to 6 liters of blood, whereas a female body contains 4 to 5 liters. why do you think there is a differenc

e between the two?
Biology
1 answer:
GrogVix [38]3 years ago
7 0
There are a couple of reasons why men have a higher blood volume than women, and here are some of them:
1. they are taller - given that usually male bodies are larger than those of women, they need more blood to flow through such a vast vessel
2. men have testosterone - this hormone increases the production of erythrocytes, or red blood cells
3. women menstruate - during this period of month, women lose a portion of the blood, which is why they have less 
You might be interested in
The autonomic nervous system connects an animal's ____
Katarina [22]
Muscles and internal organs
5 0
2 years ago
Read 2 more answers
What is the correct term for developing
11111nata11111 [884]

Answer:

please give me brainlist and follow

Explanation:

Following fertilization the embryonic stage of development continues until the end of the 10th week (gestational age) (8th week fertilization age). The first two weeks from fertilization is also referred to as the germinal stage or preembryonic stage.

3 0
3 years ago
Read 2 more answers
Dietary fiber has been recommended for its possible benefits in reducing heart disease by lowering blood cholesterol. How does f
malfutka [58]

Answer:

By lowering the levels of total cholesterol and low density lipoprotein (LDL)

Explanation:

Dietary fibers are classified into two: the soluble fiber and the insoluble fiber. Studies have show that the soluble fiber play a significant role in lowering blood cholesterol, hence reducing the cardiovascular diseases.

Soluble fiber helps to lower blood cholesterol by its ability to bind to the small intestine which further binds to cholesterol most especially the ad cholesterol (low density lipoprotein). Binding of Fibers to cholesterol prevents them from migrating to the blood stream and to other  parts of the body. Since cholesterol can't get into the bloodstream, it exits the body through feces. Fiber has more effect on lowering LDL (bad cholesterol) than High density lipoprotein (good cholesterol.

5 0
3 years ago
What are the simplest types of eukaryotes
Kaylis [27]

Answer:

The Simplest of Eukaryotic Cells. Microsporidia are intracellular parasites that infect most other eukaryotic cells, although arthropods are the most commonly parasitized. They are the simplest and smallest eukaryotic cells and thus represent a textbook example of reductive evolution [1].

Link: https://designmatrix.wordpress.com/2009/03/10/the-simplest-of-eukaryotic-cells/

3 0
3 years ago
Where would a star the same size of the sun have to be located, in order to appear brighter than the sun?
Mama L [17]
D because the sun is an average sized star
6 0
3 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Using the processes of diffusion and osmosis molecules(particles) always move from?
    14·2 answers
  • A nurse is teaching a client about human immunodeficiency virus (hiv). what are the various ways hiv is transmitted? select all
    12·1 answer
  • Choose all the answers that apply.
    12·2 answers
  • What are the answers for 9 & 10
    9·1 answer
  • Each body cell of a chimpanzee contains 48 chromosomes. After mitosis, how many chromosomes are present in each cell?
    15·2 answers
  • Which solution is hypertonic?
    11·2 answers
  • Select the correct locations on the image.
    15·1 answer
  • How many cherry pies have 90 or more cherries?
    14·1 answer
  • How does blood defend against pathogens and toxins
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!