1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PilotLPTM [1.2K]
3 years ago
13

John and sue are expecting a child, but are concerned about a rare autosomal recessive disease that is present in both of their

families. in the pedigree below, john is represented as individual iii-11 and sue is represented as individual iii-12. john\'s sister, iii-10, and sue\'s brother, iii-13, both do not show evidence of the disease, but john\'s paternal grandmother and sue\'s maternal grandfather both had the disease. assign the appropriate symbol to each individual in the pedigree.

Biology
1 answer:
Vladimir79 [104]3 years ago
8 0
Attached is the pedigree. I found the exercise on the internet.

The individuals that are missing a symbol are: II-5, II-6, II-8, III-10, III-11, III-12, III-13.

The individual II-5 would have the half black/half white square. A square because in the introductory text says that it's John's paternal grandmother (I-2) that has the disease. Half black/half white because his mother had the disease so she passed one allele that's necessarily a disease allele, and his father doesn't carry the disease or manifest it which means that from him, John's father (II-5) only received a normal allele.

The individual II-6 would have a question mark in a circle. A circle because she is John's mother once his father is the individual II-5. A question mark because we don't have information as for the manifestation of the disease in her, though we do know that she is either a carrier of the disease or inflicted by the disease because she has a daughter (John's sister) that has the disease meaning that John's sister received two alleles for the disease.

The individual II-8 would have the half black/half white circle. A circle because she is Sue's mother once her father is the individual II-7 (a square). Half black/half white because her father had the disease so he passed one allele that's necessarily a disease allele, and her mother doesn't carry the disease or manifest it which means that from her, Sue's mother (II-8) could only received a normal allele.

The individual III-10 would have a question mark in a circle. A circle because she is John's sister as said in the introductory text. A question mark because we can't affirm whether she is a carrier of one disease allele or does not carry the disease at all. We know by the introductory text that she doesn't have any signs of the disease but she could've have received a disease allele from her father or her mother if her mother is simply a carrier of one disease allele, or would definitely received a disease allele from her mother, and not from her father, if her mother has the disease.

John, the individual III-11 would have a question mark in a square. A square because is John, a male. A question mark because we can't affirm whether he is a carrier of one disease allele or does not carry the disease at all. We gather, by the introductory text, that he doesn't have signs of the disease but he could've have received a disease allele from his father or his mother if his mother is simply a carrier of one disease allele, or would definitely received a disease allele from his mother, and not from his father, if his mother has the disease.

Sue, the individual III-12 would have a question mark in a circle. A circle because is Sue, a female. A question mark because we can't affirm whether she is a carrier of one disease allele or does not carry the disease at all. By the introductory text, we gather that she doesn't have signs of the disease, but she could've have received a disease allele from her mother, once her mother is a carrier of a disease allele, turning her into a carrier as well, or could've received the normal allele from her mother. From her father she only received a normal allele.

The individual III-13 would have a question mark in a square. A square because he is Sue's brother according to the introductory text. A question mark because we can't affirm whether he is a carrier of one disease allele or does not carry the disease at all. We know, by the introductory text, that he doesn't show any signs of the disease, but he could've have received a disease allele from his mother, once his mother is a carrier of a disease allele, turning him into a carrier as well, or could've received the normal allele from his mother. From his father he only received a normal allele.

You might be interested in
Which process releases energy instead of using energy?
VLD [36.1K]

i believe the answer is d. hope it helps

5 0
3 years ago
Read 2 more answers
Can you share some interesting information about HIV?​
Fed [463]
HIV CAME FROM CHIMPS
3 0
2 years ago
Read 2 more answers
Which state of matter is the most dense?
Lubov Fominskaja [6]
Solid. it's all stuck and linked together, while liquids are flowing along and gases fly around wherever they please. Hope this helps
4 0
3 years ago
Ryan wants to see if storing his batteries in the refrigerator will make them last longer. He goes to Target and buys four batte
bulgar [2K]
<span>The battery which Ryan kept in fridge, assuming it was well protected from any moisture or water, it would tend to play the CD longer than the one stored in a desk drawer. This is because storing batteries in a cool dry location while protected from any moisture or water, can help to prolong shelf life. This is due to the fact that low temperatures tends to slow down the electric current flow within the electrolyte fluid inside the battery, hence, the rate of power dissipation is reduced thus slowing down of the power drain from battery by the electric current flow . Thus, the battery stored in the fridge tends to have lost less power, if any, compared to the one stored in a desk drawer.</span>
8 0
3 years ago
A geneticist wants to determine what mutation in a DNA molecule changed the structure of a specific protein. What would the scie
Serhud [2]

Answer:

Explanation: 1+1

3 0
2 years ago
Other questions:
  • Choose all of the body fluids that transmit the HIV virus:
    15·1 answer
  • Which is made from the remains of dead plants over millions of years? A. uranium B. natural gas C. oil D. coal
    12·1 answer
  • What is the most likely cause of plate movement?
    6·2 answers
  • Students have expressed a protein according to the BASIL protocols. They collected a pre-induction sample, a post-induction samp
    8·1 answer
  • Scientists who rely on creativity also tend to be persistent when they pursue a research goal. How might persistence be an advan
    9·2 answers
  • Compare and contraste the 5 main climate types
    6·1 answer
  • Read the excerpt from "Hansel and Gretel”
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • On the basis of first aid methods , one the following must be done
    9·1 answer
  • If you have 100 apples and you take 30 how many do you have?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!