1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leya [2.2K]
2 years ago
13

What is the structure that functions as the main food producer for the survival of the plant

Biology
1 answer:
Tems11 [23]2 years ago
7 0

Answer:

ahhhh

Explanation:

ahhhhhh

You might be interested in
The brain of an alzheimer's victim displays plaques, which are _____, and tangles, which are _____.
pav-90 [236]

Scientists can also glimpse the awful effects of Alzheimer's disease when they look at brain tissue beneath the microscope:

Alzheimer's tissue has numerous fewer nerve cells and synapses than a well brain.

<span> <span>Plaques, unusual clusters of protein particle, which are construct up between nerve cells.</span> </span> <span> <span><span>Dead and dying nerve cells contain tangles,</span> which are produce of twisted strands of a further protein.</span> </span>

<span>Scientists are not absolutely sure what causes cell death and tissue deficiency in the Alzheimer's brain, but plaques and tangles are key suspects.</span>

3 0
3 years ago
Name two processes for which dna is responsible for
ololo11 [35]

Answer:

Explanation:

DNA contains the instructions needed for an organism to develop, survive and reproduce.

Contains the genetic instructions for the development and function of living things

The main role of DNA in the cell is the long-term storage of information.

6 0
3 years ago
Read 2 more answers
What are the benefits of the cluster of curriculum ?​
soldier1979 [14.2K]
So the teachers can focus instructions to meet all the students academic needs
8 0
2 years ago
Read 2 more answers
How does a scientific explanation differ from a nonscientific explanation?
Talja [164]
A scientific explanation is backed up with data, experiments, observations, and has a large amount of evidence. A non-scientific explanation is usually backed up with beliefs, and opinions. There is no "science" behind that type of explanation.
4 0
3 years ago
Outline the life cycle of the protist parasite Trypanosomiasis
Aneli [31]

Answer:

Involves two intermediate hosts which are :

Explanation:

The life cycle of Trypanosoma cruzi involves two intermediate hosts: the invertebrate vector (triatomine insects) and the vertebrate host (humans) and has three developmental stages namely, trypomastigotes, amastigotes and epimastigotes

3 0
1 year ago
Other questions:
  • 6. What is a controlled experiment? *
    15·1 answer
  • Your grandmother is very impressed with the size of the tomatoes from a plant that she planted in her garden. These tomatoes are
    9·1 answer
  • Primates that walk on two feet are now called
    5·2 answers
  • How do scientists know about the liquid outer core? How do scientists know that the outer core is liquid?
    7·1 answer
  • Place the following in order from smallest to largest amino acid, globular structure, c,h,o,n
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which characteristic of coastal dynamics limits the abundance of aquatic organisms?
    10·2 answers
  • Carbohydrates are chains of what smaller organic molecule
    13·1 answer
  • When the M phase begins during the cell cycle, it starts with____.
    9·2 answers
  • Which of the following is not a part of environmental science?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!