1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
2 years ago
13

What is the definition of petroleum?

Biology
1 answer:
natima [27]2 years ago
6 0

Answer:

Petroleum is a liquid mixture of hydrocarbons that is present in certain rock strata and can be extracted and refined to produce fuels including gasoline, kerosene, and diesel oil

Explanation:

Oily flammable bituminous liquid that may vary from almost colorless to black, occurs in many places in the upper strata of the earth, is a complex mixture of hydrocarbons with small amounts of other substances, and is prepared for use as gasoline, naphtha, or other products by various refining processes.

You might be interested in
How did the carbon atom get into cellular respiration
Pepsi [2]

Carbon atoms are converted into metabolites like acetic acid, lactic acid, aldehydes, etc via the action of different bacteria. In the process of fermentation or cellular respiration, carbon atoms are cleaved into three carbon molecule called pyruvate then eventually forming into metabolites.

4 0
3 years ago
Read 2 more answers
The process of DNA replication
Molodets [167]

Answer: Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Several enzymes and proteins then work together to prepare, or prime, the strands for duplication. Finally, a special enzyme called DNA polymerase organizes the assembly of the new DNA strands. The following description of this three-stage process applies generally to all cells, but specific variations within the process may occur depending on organism and cell type.

Explanation:

7 0
2 years ago
Explain the working method of tongue​
melamori03 [73]

Explanation:

Chewing, grinding, pressing, salivating

When we chew, the tongue and the cheeks work together to constantly move the food between the teeth so that it can be chewed. The tongue presses the crushed food against the palate and moves this bolus, which is then ready to be swallowed, to the throat.

3 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Give Force A and B a value that would cause the forces to be balanced..<br> Force A:<br> Force B:
Usimov [2.4K]

Answer:

force a

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Which part of the brain is responsible for coordinating muscle movements and maintaining balance?
    14·1 answer
  • White blood cells can be found in what liquids?
    12·1 answer
  • Is sperm a type of hormone
    7·1 answer
  • People always say that leeches can be removed from the body by pouring salt on them. based on what the student learned about osm
    14·1 answer
  • Explain 2 important differences between the structure of dna and the structure of rna.
    8·1 answer
  • The electromagnetic waves with the shortest wavelengths and the highest frequencies are called
    11·2 answers
  • In Andalusian fowls,black individuals (B) and white individuals (W) are homozygous.A homozygous blackboard is crossed with a hom
    10·1 answer
  • Sodium is an example of an alkali metal. The alkali metals are found in the leftmost column of the periodic table, known as Grou
    14·1 answer
  • Activators are specific DNA sequences which increase the rate of transcription.
    9·2 answers
  • Hızlanma hareketine 3 er örnek​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!