Answer:
In geology, aseismic creep or fault creep is measurable surface displacement along a fault in the absence of notable earthquakes. An aseismic creep exists along the Calaveras fault in Hollister, California.
Explanation:
:) hope this helps
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The answer is B and D i learned this in biology last week
Answer:
Explanation:
The main goal of metabolism is for the ultimate release of energy. Energy is simply a function of the ability to do work. In this context, we consider energy in one of it forms, chemical energy.
The chemical energy obtained through digestion of food mostly in the form of glucose is the fuel for almost all of life's processes. This chemical form of energy serves as the power house for our functioning.
Energy is required by the brain to power it and carry out its function. Without energy being supplied to the brain, there won't be a living being.
Energy is needed for locomotion and other life activities. The muscles, bones and other appendages gets their coordination power from the energy released during metabolic processes.
It can be said that all life activities revolves round how organisms obtains and utilize energy.
Nutrients are the nourishment we derive from feeding. The nutrients helps to build our body parts e.g proteins. Energy are derieved from carbohydrates. Fats and oil are also energy sources and they help life functions. Vitamins and minerals supplies needed materials to make everyday life activities successful.